ID: 999138850

View in Genome Browser
Species Human (GRCh38)
Location 5:149343594-149343616
Sequence TTTCTTTTGCTTCCTTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999138850_999138853 7 Left 999138850 5:149343594-149343616 CCTTAACAAGGAAGCAAAAGAAA No data
Right 999138853 5:149343624-149343646 CTAAGAAACTAAAAGGGTGCTGG No data
999138850_999138851 0 Left 999138850 5:149343594-149343616 CCTTAACAAGGAAGCAAAAGAAA No data
Right 999138851 5:149343617-149343639 TAAAATACTAAGAAACTAAAAGG No data
999138850_999138852 1 Left 999138850 5:149343594-149343616 CCTTAACAAGGAAGCAAAAGAAA No data
Right 999138852 5:149343618-149343640 AAAATACTAAGAAACTAAAAGGG No data
999138850_999138854 27 Left 999138850 5:149343594-149343616 CCTTAACAAGGAAGCAAAAGAAA No data
Right 999138854 5:149343644-149343666 TGGACACAGTTACTTTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999138850 Original CRISPR TTTCTTTTGCTTCCTTGTTA AGG (reversed) Intergenic
No off target data available for this crispr