ID: 999138853

View in Genome Browser
Species Human (GRCh38)
Location 5:149343624-149343646
Sequence CTAAGAAACTAAAAGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999138850_999138853 7 Left 999138850 5:149343594-149343616 CCTTAACAAGGAAGCAAAAGAAA No data
Right 999138853 5:149343624-149343646 CTAAGAAACTAAAAGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999138853 Original CRISPR CTAAGAAACTAAAAGGGTGC TGG Intergenic
No off target data available for this crispr