ID: 999140429

View in Genome Browser
Species Human (GRCh38)
Location 5:149357969-149357991
Sequence AGGAAGGCGGGACTGCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999140422_999140429 4 Left 999140422 5:149357942-149357964 CCAATGCGGAGCTGGGTCTGGCG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 999140429 5:149357969-149357991 AGGAAGGCGGGACTGCCAGTGGG 0: 1
1: 0
2: 2
3: 11
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999140429 Original CRISPR AGGAAGGCGGGACTGCCAGT GGG Intergenic
900824316 1:4913868-4913890 AGGAAAGCCGGACTGTCAGCAGG - Intergenic
900833781 1:4984678-4984700 ATGAATGGGGAACTGCCAGTGGG - Intergenic
901231194 1:7642472-7642494 AGGCAGGCGGGCCTGACAGCAGG - Intronic
902481190 1:16712776-16712798 GGGGAGGCGTGACTGGCAGTGGG - Intergenic
902853979 1:19186090-19186112 AGGCAGGAGGGCATGCCAGTGGG + Intronic
903301082 1:22379249-22379271 AGGAAGGCCGGGCAGCCAGAGGG - Intergenic
903305858 1:22412686-22412708 AAGAATGCTGGACTTCCAGTTGG - Intergenic
904531513 1:31172837-31172859 AGGAAGTGGGGACTGCTAATTGG - Intergenic
907526940 1:55059307-55059329 AGGAAGACTGTTCTGCCAGTGGG - Intronic
907556147 1:55345714-55345736 AGGAATGCTGGCCTTCCAGTGGG + Intergenic
909459452 1:75893405-75893427 AGGAATGGGAGACTACCAGTTGG + Intronic
916005276 1:160654022-160654044 GGGAAGAAGGCACTGCCAGTGGG - Intergenic
919823926 1:201490486-201490508 AGGCAGGCGGGATGGCCAATGGG + Intronic
922809196 1:228406578-228406600 AGGAAGGCGGTACTGTCCGCGGG + Exonic
1062887830 10:1032497-1032519 AGGAAGGAGGGACAGGCAGGGGG - Intergenic
1067344217 10:45426308-45426330 AGGTGGCCGGGACTCCCAGTGGG - Intronic
1070732243 10:78838506-78838528 AGGAAGGCTACTCTGCCAGTTGG - Intergenic
1071245759 10:83761008-83761030 AGGAAGGAGGGACAGGCAGATGG + Intergenic
1071913056 10:90257582-90257604 AGGACTGGGGGACTGCCAATTGG + Intergenic
1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG + Intronic
1073336436 10:102714054-102714076 AGGAAGGCGGGGCTTGCAGCGGG - Intronic
1074842112 10:117364894-117364916 AGGAAGGAGGGAGTGAAAGTGGG + Intronic
1075345186 10:121676700-121676722 AGGAATGCCGGGGTGCCAGTGGG + Intergenic
1075625860 10:123964199-123964221 AGGAAGGAGGTGCTGCCAGAGGG - Intergenic
1076321051 10:129581789-129581811 AGGAGGACGGGACGGCCACTGGG - Intronic
1077093053 11:788250-788272 AGGAAGATGAGGCTGCCAGTGGG - Exonic
1077459499 11:2701657-2701679 AGGAAGGTGGGAAAGCCACTTGG - Intronic
1077537169 11:3129931-3129953 GGAAAGGCAGGTCTGCCAGTGGG - Intronic
1078550545 11:12277226-12277248 AACAAGCCTGGACTGCCAGTTGG - Intronic
1079349911 11:19683666-19683688 AGAAAGGCTGGGCTTCCAGTCGG + Intronic
1083170346 11:60920658-60920680 AGGAAGGAGAGACAGCCTGTTGG + Intronic
1083176179 11:60951651-60951673 AGAAAGGAGGGCCAGCCAGTTGG - Exonic
1084474497 11:69381102-69381124 AGGAAGGCTGGACAGCCAGTGGG + Intergenic
1084641979 11:70431636-70431658 AGGAGGGCAGCACTGCCATTAGG - Intronic
1089303265 11:117511396-117511418 AGGAAGGCAGGGCTGCAACTGGG - Intronic
1095383310 12:41619949-41619971 AGGAAGGAGGCACTTGCAGTGGG + Intergenic
1097180902 12:57171347-57171369 AGGAGGGAGGGTCTTCCAGTGGG + Intronic
1097223094 12:57461766-57461788 GGGAAGGCGGGACCGGGAGTAGG + Intronic
1103231756 12:119337015-119337037 AGGAAGGAGGGCCTGGCAGGTGG + Intronic
1104500380 12:129279647-129279669 AGGATGGTGGGATTGCCAATGGG - Intronic
1104599937 12:130145970-130145992 AGGAAAGTGGGACAGACAGTGGG - Intergenic
1105978376 13:25493862-25493884 AGGAAAGGAGGGCTGCCAGTAGG + Intronic
1107793517 13:44026712-44026734 AGGAAGAAGGGTCTGCTAGTGGG - Intergenic
1108482159 13:50884423-50884445 AGGAAAGCGAGACTGGCAGAGGG + Intergenic
1111074374 13:83213941-83213963 AGGAAGTTGGGCCTGTCAGTAGG + Intergenic
1112367980 13:98772053-98772075 GGGAAGGGAGGACTGCCAGGTGG + Intergenic
1112591816 13:100770358-100770380 AGGCAGGCAGGACTCCCAGAAGG - Intergenic
1112653434 13:101423032-101423054 AAGAAGGAGGAACAGCCAGTTGG + Intergenic
1113416498 13:110132450-110132472 ATGAAGACGGCACTGCCTGTGGG - Intergenic
1114630445 14:24156165-24156187 AGCAAGGCGGGAATGGCAGGTGG + Intronic
1115256977 14:31413458-31413480 ATGATGGCGAGATTGCCAGTGGG + Intronic
1116808807 14:49519877-49519899 AGGAAGGCAGGAAGGCCAGAAGG + Intergenic
1117969796 14:61240502-61240524 AAGAGGGCAGGACTGCCAGTTGG + Intronic
1120832862 14:89013488-89013510 AGGAAGGCAGGACTGAGAGTTGG + Intergenic
1121410540 14:93745726-93745748 AGGAAGGAGGGGCTGGCAGGGGG - Intronic
1122811513 14:104291702-104291724 AGGAAGGTGGGACCTCCAGCCGG - Intergenic
1123937351 15:25200427-25200449 GGGAAGGGGGGACTTCCAGGGGG - Intergenic
1124662097 15:31558097-31558119 AGGCAGGCGGGGCTCCCACTGGG + Intronic
1125191944 15:37003750-37003772 AGGAAGTGGGGCCTTCCAGTAGG + Intronic
1128930143 15:71697040-71697062 AGGAAGGAGGGAGTGCCCTTTGG + Intronic
1129519876 15:76178871-76178893 AGACAGGCTGGACTCCCAGTGGG + Intronic
1129607122 15:77030393-77030415 GGGGAGGCGGGGCTCCCAGTGGG + Intronic
1130024942 15:80262720-80262742 AGGAATGCGGGACTCAGAGTTGG - Intergenic
1139599508 16:67978142-67978164 AGGGAGGCTGGACACCCAGTGGG - Intronic
1139699474 16:68698847-68698869 AGAAATGCAGGACGGCCAGTGGG - Exonic
1141988993 16:87599568-87599590 AGCAAAGTGGGACTGCCATTTGG - Intergenic
1142060602 16:88026953-88026975 AGGAGGGCGGGAGGGCCAGGTGG + Intronic
1142887098 17:2919658-2919680 AGGAAGGAGGGCCTGGCAGCCGG - Intronic
1143124539 17:4633120-4633142 AGGCAAGCGGGAAGGCCAGTGGG - Intronic
1143917160 17:10302581-10302603 AGGAAGGTGGGGCTGCCATGGGG - Intronic
1144758491 17:17694350-17694372 AGGAAGACGGGCCTTCCTGTGGG + Intronic
1146561582 17:33874685-33874707 AGGAGGGTGGGGATGCCAGTAGG - Intronic
1147667001 17:42155111-42155133 AGGAACGCGGGAGTGGCGGTAGG + Intergenic
1149773286 17:59338239-59338261 AGGAAGGCTTGACATCCAGTTGG + Intronic
1150124884 17:62629185-62629207 AGGAAGGCAGGAGTGCGAGGAGG - Intronic
1151130725 17:71893781-71893803 TGGAAGGTGGAACTGCCAGTAGG + Intergenic
1152302968 17:79506228-79506250 AGGGAGGAGGGAGTGCCAGGAGG + Intronic
1152623332 17:81377104-81377126 AGGAAGGCGAAGCTGCCAGGTGG + Intergenic
1155167181 18:23240695-23240717 AGGAAGACGGGACAGGCAGCAGG - Intronic
1156402041 18:36748215-36748237 AGGAAGGAAGGACAGCCAGAAGG - Intronic
1157296784 18:46450794-46450816 AAGAAGGTGGGTCTGCCAGCAGG + Exonic
1157567354 18:48688596-48688618 AGGAAGGCAAGGCTCCCAGTGGG + Intronic
1160205801 18:76830450-76830472 AGGAAGCCAGGACTGTCACTGGG - Intronic
1160511039 18:79453484-79453506 AGGCAGGAGGGGCTGCCTGTAGG - Intronic
1161103937 19:2434120-2434142 AGGAAGGTGGGACTGGTAGTGGG + Intronic
1163583971 19:18154120-18154142 AGGAAGGCGCGACAGGCAGACGG - Intronic
1165289721 19:34873567-34873589 AAAAAGGCGAGACTGCCAGAAGG + Intergenic
1166204472 19:41260001-41260023 AGGAAGACAGGGCTGCAAGTGGG - Exonic
1166931548 19:46304283-46304305 AGGGGGGCGGGACTCCCAGCAGG - Intronic
1167211553 19:48136931-48136953 AGGAGGGAGGGACTGGCAGCTGG - Intronic
1167564382 19:50247121-50247143 AGGTAGGCGGGGCTGGCGGTGGG + Exonic
927050121 2:19319842-19319864 AGGAAGGAGGGACTGACACTGGG + Intergenic
927377742 2:22437769-22437791 AGCAAGGGAGGAATGCCAGTGGG + Intergenic
927416779 2:22888387-22888409 TTGAAGGTGGGGCTGCCAGTGGG + Intergenic
929818121 2:45252099-45252121 AGGAAGGCTGGAATGGCAGGGGG + Intergenic
930331461 2:49990350-49990372 AGGAAGGAGGGAGAGCCAGGTGG + Intronic
930605880 2:53492670-53492692 AGGATGGAGTGAGTGCCAGTAGG - Intergenic
931768692 2:65479172-65479194 AGGAAGGCTGGAACGCCACTTGG + Intergenic
934762924 2:96866240-96866262 AGGCAGTCGGGCCTGCCAGAGGG - Intronic
935204031 2:100882218-100882240 AGGAAGGCGGCACTGCCACAGGG + Intronic
935742370 2:106160984-106161006 AGGAAGGGGAGAGTGCCTGTGGG + Intronic
937036378 2:118785968-118785990 AGGAAGTCTGGACTGGGAGTGGG - Intergenic
938114042 2:128591376-128591398 AGGAAGGCAGGATTTCCTGTTGG - Intergenic
940009902 2:149041592-149041614 AGGAAAGTGAGACTGCCTGTTGG + Intronic
945895369 2:215475103-215475125 AGGAAGGCGGGAGTGAGGGTTGG + Intergenic
947897360 2:233688072-233688094 AATAAGGAGTGACTGCCAGTGGG - Intronic
947944655 2:234091305-234091327 AGGCAGGCAGGACTGCAAGGGGG - Intergenic
1170822444 20:19765931-19765953 GGGAAGGAGGGACAGCCAGTGGG + Intergenic
1171237939 20:23543185-23543207 GGGCAGGCTGGAGTGCCAGTGGG + Intergenic
1173530584 20:43766535-43766557 AGAAGGCCCGGACTGCCAGTGGG - Intergenic
1175019933 20:55835124-55835146 ACGAAGGCGGGAATGTCAGAGGG - Intergenic
1175074473 20:56361097-56361119 AGGCAGGCGGGGCTGCTAGGCGG - Intronic
1175580595 20:60095808-60095830 AGGAAGGAGGAACTGACAGAAGG + Intergenic
1175901301 20:62360915-62360937 GGGAAGCCGGGACTGACACTCGG - Intronic
1179586746 21:42378202-42378224 AGGTGGGCAGCACTGCCAGTGGG + Intronic
1182582920 22:31325913-31325935 AGGAAGGTGGGACAGCCGGCAGG - Exonic
1183222831 22:36528198-36528220 AAGAAGGCTGGACTGACAGCAGG - Intronic
1183591647 22:38782626-38782648 AGGGAGGCAGGACTGCCGGCAGG - Intronic
1183607248 22:38872857-38872879 AGGAAGGCCGGAGTGACCGTGGG + Intergenic
1184501874 22:44879390-44879412 TGGAAGGCGGCACTGCGAGGAGG + Intergenic
1184633505 22:45805704-45805726 AATAAGGAGTGACTGCCAGTGGG + Intronic
1184965247 22:47966648-47966670 AGGAAGGCGGGCTTGCCAGGTGG - Intergenic
1184981205 22:48097104-48097126 AGCAAGGAGGGGCTGCCAGGTGG - Intergenic
958502997 3:94938040-94938062 AGGCAGCCGGGACTGGCAGCGGG + Intergenic
959681193 3:109098466-109098488 AGGACTGTGAGACTGCCAGTGGG - Intronic
961404245 3:126667435-126667457 ATGAAGGTGGGACTTCCTGTGGG - Intergenic
962390989 3:134972860-134972882 AGCAAGGCAGGACGGCCATTTGG - Intronic
963202121 3:142596538-142596560 AGGAAGGCTGGACAGACAGATGG + Intronic
964633018 3:158833122-158833144 AGGAAGGTGGGCCTGGCAGCAGG + Intergenic
965653899 3:170963485-170963507 AGGGAGGCGGGAATACAAGTAGG + Intergenic
967335508 3:188339575-188339597 AGGAAAGAGTGACTGCCAGCAGG + Intronic
968928596 4:3563301-3563323 AGGAAGTGGGGAATGCCGGTTGG - Intergenic
968982059 4:3855639-3855661 AGGCAGGAGGGCCTGCCAGGGGG - Intergenic
969151953 4:5177269-5177291 AGGATGGAGTGAGTGCCAGTGGG + Intronic
977546603 4:98389349-98389371 AGAATGGCAGGCCTGCCAGTCGG + Intronic
979205377 4:118032631-118032653 AGGAAGGCAGAACTGAGAGTTGG - Intergenic
980979622 4:139643153-139643175 AAGGTGGCGGGACTGCGAGTAGG - Intergenic
983501785 4:168507623-168507645 AGGAAGACAAGACTGACAGTAGG - Intronic
983849580 4:172563354-172563376 GTGAAGGCGGGATTGACAGTTGG - Intronic
985347793 4:189025150-189025172 AGGAAGACTGGAGTCCCAGTAGG + Intergenic
986225310 5:5806781-5806803 AGGCAGGTGGAACTGGCAGTAGG - Intergenic
986523652 5:8649321-8649343 CGGAAGGCGGAACTTGCAGTGGG - Intergenic
988596425 5:32596153-32596175 AATAAGGGGGGACTGGCAGTTGG + Intronic
990282001 5:54261060-54261082 AGGAATGAGGGGCTGCAAGTGGG + Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
993603922 5:89963555-89963577 AGGAAGGGGAGACTACAAGTAGG - Intergenic
994161998 5:96567376-96567398 AGGAAGGAAGGACTACCACTGGG - Intronic
994873276 5:105380783-105380805 AGGATGGAGTGACTGCCAGCAGG - Intergenic
995355267 5:111229825-111229847 AGCAAGGTGGGATTGCAAGTGGG + Intronic
998182621 5:139956043-139956065 AGGAAGGTGGGACCCCCTGTGGG + Intronic
999140429 5:149357969-149357991 AGGAAGGCGGGACTGCCAGTGGG + Intergenic
1004162813 6:13229749-13229771 AGGAGGGCAGGACTGGCTGTGGG - Intronic
1006535919 6:34698591-34698613 AGGAAGGCGGAACTGCAGGTGGG + Intergenic
1008326854 6:50192757-50192779 AGAAAGGCAGGCCGGCCAGTCGG + Intergenic
1011798527 6:90983414-90983436 AGGATGGCGGGATTGGCTGTAGG - Intergenic
1018827394 6:167420226-167420248 AGTAAAGCGGGGCTGCCAGGAGG - Intergenic
1018887908 6:167957032-167957054 AGGCAGGCTGGAGGGCCAGTGGG - Intronic
1019813532 7:3182736-3182758 AGGAGTGCGGGACTGACAGAGGG + Intergenic
1023577319 7:41642253-41642275 AAGAAGGATGGTCTGCCAGTGGG + Intergenic
1024959184 7:54957201-54957223 AGGAAGGCTGGGCGGCCAGCCGG - Intergenic
1029492529 7:100880002-100880024 AGGAAGGTCTGCCTGCCAGTGGG + Intronic
1029692312 7:102190589-102190611 AGTGAGGCGGGCATGCCAGTGGG - Intronic
1031831653 7:126634648-126634670 AGGAAGGCAGGAAGGCCAGGGGG - Intronic
1032284114 7:130528085-130528107 AGGAGGGTGGGACTGACAGGAGG + Intronic
1034470535 7:151252123-151252145 AGGAGGGCGGGACTGCGGCTGGG - Intronic
1035046945 7:155973978-155974000 AGGTAGGAAGGACTGTCAGTGGG + Intergenic
1035409070 7:158624008-158624030 ACGAAGGTGGGACTGGCAGTAGG + Intergenic
1038494175 8:27990057-27990079 AGGAAGGTGGAAATGGCAGTGGG - Intronic
1038831905 8:31071362-31071384 AGGAAGGCAGGAGTCACAGTAGG + Intronic
1039796415 8:40919289-40919311 AGTTGGGCGGGACTGCCAGGAGG - Intergenic
1041831676 8:62161976-62161998 TGGAAGAGGGGACTGTCAGTGGG - Intergenic
1043655465 8:82659862-82659884 AGGAAGCAGGGTCTGGCAGTGGG + Intergenic
1044466757 8:92515688-92515710 AGGAAGGAGGGGCTGCTTGTTGG + Intergenic
1044807980 8:96028356-96028378 AGGAAAATGGGACTGACAGTTGG - Intergenic
1045645496 8:104293291-104293313 AGGAAGGTGGCAGTGCCTGTAGG - Intergenic
1049384383 8:142333822-142333844 AGAAAGGAGGAACTGCCAGGCGG + Intronic
1049498767 8:142949920-142949942 AGGATGGCGGGACTGTCGGTGGG + Intergenic
1049544279 8:143222120-143222142 TGGAAGGCGTGGCTGCCACTCGG - Intergenic
1049600484 8:143505218-143505240 AGGCAGGCTGTCCTGCCAGTTGG - Intronic
1051692282 9:19728048-19728070 AGGAAGTGGGGACTGGGAGTGGG + Intronic
1051858510 9:21597518-21597540 GGGAAGGCGGTAGTGACAGTGGG + Intergenic
1056254421 9:84783970-84783992 TGGGAGGTGGGACTGCCACTGGG + Intronic
1056942246 9:90965520-90965542 TGGAAGGAGGGCCTGCCAGGGGG + Intergenic
1057165171 9:92920039-92920061 AGGCAAGCGGGAAGGCCAGTGGG + Intergenic
1057200556 9:93137580-93137602 AGGAGGACGGGGCTGGCAGTCGG + Intergenic
1059358517 9:113720060-113720082 ATGGAGGCGGGAGTGCCAGGAGG - Intergenic
1203657738 Un_KI270753v1:14896-14918 AGGAAGGCGGGAGTGCCGCGGGG + Intergenic
1189550291 X:42085633-42085655 AGGAAGGCAGGACGGACTGTGGG + Intergenic
1192830170 X:74743016-74743038 AGGAAGGAATGGCTGCCAGTTGG - Exonic
1193724966 X:85027325-85027347 AGGAAGTGGGGGCTGGCAGTGGG - Intronic
1201451093 Y:14116044-14116066 AGGAAGGCAGGCCAGCCAGAGGG + Intergenic