ID: 999143929

View in Genome Browser
Species Human (GRCh38)
Location 5:149380494-149380516
Sequence ACTTGTGGCCTGAATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999143929_999143937 15 Left 999143929 5:149380494-149380516 CCTCCAAGATTCAGGCCACAAGT 0: 1
1: 0
2: 1
3: 12
4: 109
Right 999143937 5:149380532-149380554 ACCTCAGGGTCCAAAGGTCCTGG 0: 1
1: 0
2: 0
3: 44
4: 2099
999143929_999143935 1 Left 999143929 5:149380494-149380516 CCTCCAAGATTCAGGCCACAAGT 0: 1
1: 0
2: 1
3: 12
4: 109
Right 999143935 5:149380518-149380540 TGTGAGGTCGGATGACCTCAGGG No data
999143929_999143934 0 Left 999143929 5:149380494-149380516 CCTCCAAGATTCAGGCCACAAGT 0: 1
1: 0
2: 1
3: 12
4: 109
Right 999143934 5:149380517-149380539 TTGTGAGGTCGGATGACCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 63
999143929_999143936 9 Left 999143929 5:149380494-149380516 CCTCCAAGATTCAGGCCACAAGT 0: 1
1: 0
2: 1
3: 12
4: 109
Right 999143936 5:149380526-149380548 CGGATGACCTCAGGGTCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999143929 Original CRISPR ACTTGTGGCCTGAATCTTGG AGG (reversed) Intronic
900373768 1:2344100-2344122 ATTTGTGGCCTGATTCTGGTGGG - Intronic
906287640 1:44598060-44598082 TCTGGAGGCCTGACTCTTGGAGG - Intronic
906784416 1:48602097-48602119 AGTTGTGGCCTGAATGCTTGGGG + Intronic
908010274 1:59769278-59769300 ACATGAGGCCTGAGTCTGGGAGG - Intergenic
916982815 1:170156839-170156861 ACTTGTGGTCTAAATGTTGCTGG + Intronic
917506451 1:175631593-175631615 ACCTGTGGCCTATATATTGGGGG + Intronic
917949821 1:180019980-180020002 ACTTGTGGGCTCAATCTTTCAGG - Exonic
1064791102 10:18958846-18958868 ACTTGTGGCCAGAATGCTGAGGG + Intergenic
1064923858 10:20548885-20548907 ACTTGTGGCTTGATTCTTTTGGG - Intergenic
1065223258 10:23517777-23517799 ACTGGCTGCCTGAATCTTGAAGG + Intergenic
1067265708 10:44742515-44742537 GCTTGTGGCCAGAATCTGGGAGG + Intergenic
1068917916 10:62452652-62452674 AGTTTTGGCCTGAATCTGAGAGG + Intronic
1070473937 10:76813816-76813838 ACTTGGGGCCTGGATCTTATAGG - Intergenic
1071251807 10:83826484-83826506 TCTTGTGGCCTGAACCACGGGGG + Intergenic
1088131134 11:106492408-106492430 AATTGTGACCTGAGTTTTGGAGG - Intergenic
1089080696 11:115774007-115774029 ACTTGCTGCCTGAATCTGGCAGG + Intergenic
1091314982 11:134608244-134608266 ACCTGAGGCCTGAATCTGAGGGG - Intergenic
1094324747 12:29225009-29225031 ACTTGTGGCCTCAAGTTTGGAGG - Intronic
1096634197 12:52948383-52948405 ACTTGTGGAGGGGATCTTGGGGG - Intronic
1100219183 12:92485533-92485555 TCCTTTGACCTGAATCTTGGGGG - Intergenic
1102429445 12:112870493-112870515 ATTTCTGGCCTCACTCTTGGTGG + Intronic
1102541107 12:113619775-113619797 ACTGGCTTCCTGAATCTTGGAGG - Intergenic
1103162306 12:118739695-118739717 ACATCTGAACTGAATCTTGGAGG + Intergenic
1103746255 12:123126427-123126449 GCTTTTCGCCTGAAGCTTGGTGG - Intronic
1105862009 13:24424032-24424054 ACTTCTGGGCTTGATCTTGGTGG + Intronic
1106292560 13:28378539-28378561 TCTTCTGGTCTGAACCTTGGAGG + Intronic
1108546646 13:51501808-51501830 ACATGTGGGCTGAGTCTTGAAGG - Intergenic
1109740968 13:66554578-66554600 ACTTGTGCCCTGATTTTTTGAGG - Intronic
1110769932 13:79330837-79330859 ACTTGAGGTCTGAAGCTTGTGGG - Intronic
1111707007 13:91762854-91762876 ACTTTTGTCTTGAATCTTAGGGG + Intronic
1114412969 14:22517925-22517947 TCCTGTGGTCTGAATCCTGGTGG - Intergenic
1115076208 14:29394141-29394163 ACCTGTGTCCTGACTCTTGTTGG - Intergenic
1116408321 14:44593593-44593615 ACTGAAGGCCTGAACCTTGGAGG - Intergenic
1119710249 14:76816944-76816966 ACTAATGGCCTCAATCTTTGGGG - Intronic
1120734221 14:88035453-88035475 ACATTTGTCCTGAATCTTGAAGG + Intergenic
1120901839 14:89582082-89582104 ACATGTGGCATGACACTTGGTGG - Intronic
1122796984 14:104210879-104210901 CCTTGTGGCGTGGGTCTTGGGGG + Intergenic
1126405100 15:48315354-48315376 TCTTGTGGCCTGATTCTTCCTGG - Intergenic
1128492519 15:68162971-68162993 AGATGTGCCCTCAATCTTGGCGG - Intronic
1131225140 15:90618399-90618421 ACTTGTCTACTGACTCTTGGAGG - Intronic
1134691333 16:16192616-16192638 GCCTGTGGCCTGAACATTGGAGG + Intronic
1134856442 16:17523870-17523892 CCTTGTGGCCTGCATGTTTGTGG + Intergenic
1135048756 16:19175292-19175314 AGTTGTGGCCTGAATCCTACAGG + Intronic
1135048933 16:19176874-19176896 AGTTGTGGCCTGAATCCTACAGG - Intronic
1138090813 16:54172971-54172993 GCTTGTAGCCTGATTATTGGAGG + Intergenic
1138459959 16:57142303-57142325 ACATGTGAGCTGAAACTTGGAGG + Intronic
1139436390 16:66939055-66939077 GCCTGTGGCCTGTAACTTGGTGG + Intronic
1145846496 17:28042607-28042629 ACTTGTGGCAGGAATCCTGGGGG + Exonic
1152353204 17:79794772-79794794 CCCTGTGGCCAGAATCCTGGGGG - Exonic
1153914479 18:9733631-9733653 ACCTGTGGACCGAATCCTGGAGG - Intronic
1155627889 18:27857563-27857585 ACTTTTGGCCTGAGACTTTGGGG + Intergenic
1155831541 18:30521845-30521867 ACTGGTGGCTTGAATATAGGGGG - Intergenic
1158035095 18:53019015-53019037 ACTTGGTGCCTGAATTTTGTAGG + Intronic
1158810999 18:61034417-61034439 TCTTGTTGTCTGCATCTTGGAGG - Intergenic
1159062674 18:63532447-63532469 GGTTGGGGCCTGAATGTTGGGGG + Intergenic
1159840725 18:73395531-73395553 ACTTGTACCCTGAGTCTTGGAGG - Intergenic
1159857393 18:73605368-73605390 AGTTGTGGACTGAAGGTTGGTGG - Intergenic
1163672779 19:18638243-18638265 ACCTGTGGGCTGATTGTTGGAGG + Intronic
1164616882 19:29672608-29672630 ACTCATGGCTTGAATATTGGAGG + Intronic
1167114861 19:47483364-47483386 CCTTGTCCCCTGAATCCTGGCGG + Exonic
927952559 2:27182576-27182598 ACTTGTGGTCTGAATCTCGCTGG + Intergenic
930914069 2:56666179-56666201 ACTTGTGGGCTCAATATTAGAGG - Intergenic
931703217 2:64925414-64925436 ACATGTGGCCTGAATTTTGGGGG + Intergenic
933776852 2:85776274-85776296 GCTTGGGGCCTGAGGCTTGGAGG + Intronic
937583488 2:123517523-123517545 ACATGTGGGCTGGATCTTGATGG - Intergenic
938246381 2:129780587-129780609 GCCTGGCGCCTGAATCTTGGAGG - Intergenic
938797630 2:134731584-134731606 ACTGGTGGGCAGAATCTGGGAGG - Intergenic
940364508 2:152833038-152833060 AATTGCGGCCTGAACCTGGGAGG - Intergenic
940821641 2:158362158-158362180 ACTTGTGTTATGAATCTGGGTGG - Intronic
941426121 2:165347622-165347644 ACTAGTGTCCTGAATCTTGAAGG + Intronic
942378528 2:175362061-175362083 ACTTGTGGCCTGGTTTTGGGGGG + Intergenic
943688301 2:190842651-190842673 TCTTGAAGCCTGACTCTTGGAGG + Intergenic
944556433 2:200891860-200891882 ACTTTAGGCCTGGATCTTTGAGG - Intronic
947143770 2:227044628-227044650 ACTTGTCTCCTGAATTTTGTGGG + Intronic
1170071350 20:12372520-12372542 ACTTGGGGTGTGAATTTTGGAGG - Intergenic
1170138659 20:13103361-13103383 ACATTTGGGCTGAATCTTGAAGG + Intronic
1170212676 20:13860942-13860964 ACTTATGGCCTGAACAATGGGGG - Intronic
1171435506 20:25119908-25119930 GTTTGTGGCCTTCATCTTGGTGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1175104608 20:56605702-56605724 TCTTGAGGCCTGGATCTTGCTGG + Intergenic
1177843719 21:26263590-26263612 ATTTGTGGCCTGAATCTAACTGG + Intergenic
953031925 3:39185195-39185217 GCCTGTAGCCTGATTCTTGGTGG + Exonic
953419230 3:42741772-42741794 ACTTTTGGCCTGTATCTTGAAGG - Intronic
954983863 3:54771817-54771839 ACTTGGGGCAGAAATCTTGGGGG + Intronic
962957310 3:140278200-140278222 AATTGTGGCCTGAATTTATGAGG + Intronic
964623271 3:158735813-158735835 ACTTGTGCCCTGTATCTTATTGG + Intronic
977903810 4:102453572-102453594 ACTTGTGGTCTGAATTGTGGTGG - Intergenic
979496966 4:121394441-121394463 CTTTGTGGCCTGAATTTGGGAGG + Intergenic
982322686 4:154096164-154096186 ACTTGTGGGTTCAATCATGGTGG + Intergenic
982914288 4:161185927-161185949 ACTTGTGGCATGAAGTGTGGTGG - Intergenic
986293592 5:6419247-6419269 ACTTATAGCCTGAATCTTTGGGG - Intergenic
992686265 5:79202449-79202471 ATTTCTGGCCTGAATCTTCAAGG - Intronic
996620861 5:125500929-125500951 AATTCTAGCCTGAACCTTGGAGG - Intergenic
999143929 5:149380494-149380516 ACTTGTGGCCTGAATCTTGGAGG - Intronic
1004515776 6:16321274-16321296 ACTTATGGCCTCAAACTTGGAGG + Intronic
1007418919 6:41707634-41707656 ACCTGTAGCCTGAAGCTGGGAGG + Intronic
1007774562 6:44217714-44217736 ACTTGTGGCCTCACTTTTGGGGG - Intergenic
1010862063 6:80925129-80925151 ATCTGTGGCTTGAAACTTGGAGG - Intergenic
1013175970 6:107676754-107676776 TCATGTGGCCTGTTTCTTGGTGG + Intergenic
1017038277 6:150286591-150286613 ACTTGTGGCTTTATTCTTTGGGG - Intergenic
1017967820 6:159281575-159281597 ACTTGTGCCCTCAATATTTGAGG + Intergenic
1018224410 6:161614257-161614279 ACTAGAGGACAGAATCTTGGAGG + Intronic
1019384967 7:749783-749805 AGTAGTTGCCTGAATCTGGGAGG - Intronic
1023345880 7:39270813-39270835 AATTGGGGCCAGAATATTGGTGG - Intronic
1023972802 7:45003747-45003769 TCTTGTGGCCTTAACCTTGTGGG + Intronic
1025232066 7:57209231-57209253 ACTTGTGGGCTGAGTCCTGAAGG + Intergenic
1027771634 7:82414639-82414661 ACTTGTAGCCTGAATCAATGTGG - Intronic
1030262434 7:107580057-107580079 ACTTTTGACCTGATGCTTGGAGG - Intronic
1033831517 7:145259911-145259933 ACATTTGGCCTGACTCTTGTGGG + Intergenic
1041554866 8:59142106-59142128 CCTTGTCACCTGAAACTTGGAGG - Intergenic
1043808432 8:84703225-84703247 CCTAGTGGCTTGAATCTTGGAGG - Intronic
1048930120 8:139308312-139308334 ACCTGAGGCTTTAATCTTGGAGG + Intergenic
1052003038 9:23310963-23310985 TCTTGTGGCCTGCTTCTTAGGGG - Intergenic
1053560979 9:39193902-39193924 ACCTGTGGCCTGTTTCCTGGGGG + Intronic
1053825080 9:42014151-42014173 ACCTGTGGCCTGCTTCCTGGGGG + Intronic
1054136140 9:61425053-61425075 ACCTGTGGCCTGTTTCCTGGGGG - Intergenic
1054605490 9:67173212-67173234 ACCTGTGGCCTGCTTCCTGGGGG - Intergenic
1186830407 X:13384456-13384478 ACTTTTGGCCCGTACCTTGGGGG - Intergenic
1189385391 X:40532893-40532915 AATAATGGCCTGAATCTGGGAGG - Intergenic
1189553584 X:42118524-42118546 CTTTGTGGGCTGTATCTTGGTGG + Intergenic
1197759185 X:130015683-130015705 GCTTGTGGCCTGAAGCTGGCAGG + Exonic
1198371013 X:135989067-135989089 ACCAGTGGGCTGAATCTTAGAGG - Intronic
1199917416 X:152358996-152359018 ACTTGTGGCCTATATCCTTGAGG - Intronic