ID: 999144026

View in Genome Browser
Species Human (GRCh38)
Location 5:149380980-149381002
Sequence GGGCTGGGACAGCCTGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999144026_999144032 -7 Left 999144026 5:149380980-149381002 CCCACCGCAGGCTGTCCCAGCCC 0: 1
1: 0
2: 4
3: 30
4: 287
Right 999144032 5:149380996-149381018 CCAGCCCCAGCCCCACTGGCCGG 0: 1
1: 0
2: 2
3: 108
4: 739
999144026_999144038 2 Left 999144026 5:149380980-149381002 CCCACCGCAGGCTGTCCCAGCCC 0: 1
1: 0
2: 4
3: 30
4: 287
Right 999144038 5:149381005-149381027 GCCCCACTGGCCGGGCGGCCTGG No data
999144026_999144033 -6 Left 999144026 5:149380980-149381002 CCCACCGCAGGCTGTCCCAGCCC 0: 1
1: 0
2: 4
3: 30
4: 287
Right 999144033 5:149380997-149381019 CAGCCCCAGCCCCACTGGCCGGG No data
999144026_999144043 18 Left 999144026 5:149380980-149381002 CCCACCGCAGGCTGTCCCAGCCC 0: 1
1: 0
2: 4
3: 30
4: 287
Right 999144043 5:149381021-149381043 GGCCTGGCTGTGTTCTGTGCTGG No data
999144026_999144035 -3 Left 999144026 5:149380980-149381002 CCCACCGCAGGCTGTCCCAGCCC 0: 1
1: 0
2: 4
3: 30
4: 287
Right 999144035 5:149381000-149381022 CCCCAGCCCCACTGGCCGGGCGG 0: 1
1: 0
2: 10
3: 89
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999144026 Original CRISPR GGGCTGGGACAGCCTGCGGT GGG (reversed) Intronic
900299359 1:1969281-1969303 GGGCTGGGAAGGCCTGGGCTGGG - Intronic
900310761 1:2032183-2032205 GGGGTGGGACAGGCTGGGGATGG + Intergenic
900330442 1:2131688-2131710 GGCGGGGGACAGCCTGCAGTTGG - Intronic
900409891 1:2507760-2507782 GGCCTAGGACAGCCTGTGCTTGG + Intergenic
900863842 1:5253228-5253250 GTGCGGGGCCAGCCTGCAGTTGG - Intergenic
900875579 1:5340357-5340379 GGGCTGGGACAGAGTGCTCTGGG - Intergenic
901237059 1:7672860-7672882 GGGCTGGGCCAGCAGGGGGTGGG - Intronic
901441511 1:9281139-9281161 GGTATGTGAGAGCCTGCGGTGGG - Intergenic
902241799 1:15094765-15094787 GGGCTGGGACAGCTGCCGGCGGG - Intronic
902374298 1:16023053-16023075 GGGCTGGGGCAGCCTGCACTTGG + Intronic
902379252 1:16044930-16044952 GGGCTGGGGCAGCCTACACTTGG + Intronic
903263717 1:22144108-22144130 GGGCTGCAACAGCCTGTGCTTGG + Intergenic
903295273 1:22339542-22339564 GGGCTGGGCCAGGCTGCACTGGG + Intergenic
903621957 1:24704511-24704533 GGCCTGGGACAGCCAGGGGCTGG - Intergenic
903995159 1:27300876-27300898 GGGCTTGGGGAGCCTGTGGTGGG + Intronic
904006146 1:27364276-27364298 GGGCTGGTACAGGCTGGAGTGGG - Exonic
904249996 1:29216442-29216464 GGGCTGACACAGCCTGCAGACGG + Intronic
904433581 1:30480050-30480072 GGGCTGGGAGAGCCTGAGGAGGG + Intergenic
904482299 1:30801673-30801695 GGGCTGGCAGTGCCTGGGGTAGG - Intergenic
904482938 1:30805452-30805474 GTGCTGGGGCAGGCTGGGGTGGG + Intergenic
905798997 1:40831354-40831376 GGGCGGGGACAGTCTGGGCTGGG + Intronic
911474503 1:98359019-98359041 GAGCTGGGACAGACTAAGGTAGG + Intergenic
914847843 1:151292663-151292685 GGGGTGGGAGAGCCAGCTGTGGG - Exonic
915225053 1:154405739-154405761 GGGCTGGGGCAGCTAGCGGCTGG + Intronic
915672957 1:157505585-157505607 GGGCTGGGCCAGCCTGCGTTAGG - Intergenic
916315410 1:163443120-163443142 GGACTGGGACGGCCGGCGGGGGG - Intergenic
916922666 1:169485614-169485636 GGGCTCGGACGGCCTGAGGCTGG + Exonic
917846758 1:179026205-179026227 GGGCTGGGGCCGCCTGGGGGCGG + Intronic
918308602 1:183269269-183269291 GGACTAGGACACACTGCGGTTGG + Intronic
920183459 1:204146701-204146723 GGGCTTGGGCAGGCTGCCGTTGG + Exonic
920364680 1:205441865-205441887 GGGCCGGGTCAGCCAGAGGTGGG - Intronic
921030552 1:211332053-211332075 GGGCTGGGACAGGGTATGGTGGG + Intronic
922289471 1:224198493-224198515 GGGCTGGGACAGCCTCAGGAGGG + Intergenic
922510138 1:226158809-226158831 AGGCTTGGACAGCCTCCAGTGGG - Intronic
922711975 1:227841193-227841215 GGCCTGGGATAGCCTGAGCTGGG + Intronic
924802238 1:247335820-247335842 GGGCAGGGAGAGCCTGGGGCAGG + Intergenic
1063393690 10:5666619-5666641 GGGCGGGGCCAGTCTGCGCTGGG + Intergenic
1067595394 10:47553444-47553466 GGGCTGGGGTAGGCGGCGGTTGG - Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1069631555 10:69900148-69900170 GGTCCGGCACAGCCTGGGGTGGG - Intronic
1069831995 10:71287287-71287309 GGCCTGGGACTGCCTGCAGCTGG - Intronic
1069859463 10:71461404-71461426 GGGCTGTGACAGCCTTAGGCTGG + Intronic
1070886577 10:79905065-79905087 GGGCTGGGGTAGGCGGCGGTGGG + Intergenic
1072491276 10:95907950-95907972 GGGCTGGCGCAGGGTGCGGTGGG + Exonic
1073289196 10:102405084-102405106 GGGCTGGGCCAGGCTGCATTTGG - Intronic
1073446599 10:103584685-103584707 GGGATGGGGCAGCCGGCGGCCGG - Exonic
1074105637 10:110387995-110388017 GGGCTGGGGCAGCCTGAGCTAGG - Intergenic
1076053536 10:127353264-127353286 GGGCTGGGAAAGGATGCAGTTGG - Intronic
1076209226 10:128627165-128627187 GGGCGGGGAGAGCCAGGGGTGGG + Intergenic
1076351250 10:129816412-129816434 GGGCGGGGACAGCCTGAGGGAGG - Intergenic
1077479638 11:2807620-2807642 GCGCCAGGACAGCCGGCGGTGGG + Intronic
1077484065 11:2830829-2830851 GGGTTGGGCCAGCCTGTGCTGGG - Intronic
1077577979 11:3398762-3398784 GGGCTGAGCCAGCCTGCCCTGGG + Intergenic
1081775257 11:45671859-45671881 GGGCTGGGACCGCCTGCAGATGG - Intergenic
1083616503 11:64029027-64029049 GGGATGGGAGAGTCTGAGGTGGG - Intronic
1083662278 11:64256947-64256969 GGGCTGGAACAGCTTGTGTTAGG + Intronic
1083696799 11:64448802-64448824 GGGCAGGGGCAGGCTGGGGTGGG + Intergenic
1084231920 11:67759662-67759684 GGGCTGAGCCAGCCTGCCCTGGG + Intergenic
1084269135 11:68019812-68019834 GGGTCGGGACAGGCTGGGGTCGG + Intronic
1084385586 11:68841348-68841370 GGGGTCGGTCAGCCTGCGGGTGG - Intronic
1084667710 11:70585361-70585383 GGGCAGGGACAGCATGAGGGAGG + Intronic
1085126620 11:74006454-74006476 GGGCTGGGCCTGCCTGGGCTGGG + Intronic
1085423124 11:76380843-76380865 GGGCTGGGCCGGCCGGCGGGCGG - Exonic
1089968428 11:122672859-122672881 AGGCTGGGCCAGCCTGCAGTAGG + Intronic
1090981287 11:131724802-131724824 GAGCAGGCACAGCCTGGGGTGGG + Intronic
1091230380 11:133984327-133984349 GGGCTGGGGAAGCCTGTGGCGGG - Intergenic
1091281890 11:134386445-134386467 GAGCTGGGGCAGCCAGCTGTGGG + Intronic
1091695494 12:2625475-2625497 GCGCTGGGTCAGCCTGCCTTAGG + Intronic
1094485994 12:30926556-30926578 GGGCTGGGAGAGCCGGCGCCGGG + Intronic
1095561551 12:43572045-43572067 GGGCTGGGCCGGCCGGCGGGCGG - Intergenic
1095986262 12:48001637-48001659 GGGCGGGGCCAGGCTGCGCTGGG + Intronic
1096105367 12:48994624-48994646 GGGGCAGGACCGCCTGCGGTGGG - Intergenic
1096111597 12:49032139-49032161 GGGCAGGGTCTGCCTGGGGTTGG - Exonic
1096495454 12:52037151-52037173 GGGCTGGGACAGCGCGCGGGCGG + Intronic
1098881990 12:75926543-75926565 GGGGAGGGTCAGCCTGCAGTTGG - Intergenic
1101900198 12:108786349-108786371 GGGCTGGCAAAGCTTGTGGTCGG + Exonic
1102017641 12:109658241-109658263 GGGCTGGGACAGCCCGGAGCTGG - Intergenic
1102598468 12:114011475-114011497 GTACTGGGACAGCCGACGGTTGG - Intergenic
1103911830 12:124356195-124356217 GGGCTGGTACAGACTGCTGTTGG - Intronic
1104804287 12:131575232-131575254 GAGCAGGGCCAGCCTGCGCTGGG - Intergenic
1104845816 12:131846206-131846228 GGCCTGGGACAGCCTCCAGAGGG - Intronic
1104874684 12:132025762-132025784 GGGCTGGGACCGCCGGCCGGGGG - Exonic
1112656110 13:101453897-101453919 GGCCCGGGACAGCCTGCAGGCGG - Exonic
1113561206 13:111283206-111283228 GGGGTGGGGCAGCGTGTGGTAGG - Exonic
1115323388 14:32110295-32110317 GGGCTGGGAAAGACAGCAGTAGG + Intronic
1119433884 14:74585639-74585661 GGGCTTTGCCAGCCTGGGGTGGG - Intronic
1119709670 14:76812678-76812700 GGCCTGGGGCGGCGTGCGGTTGG - Intronic
1119766886 14:77195967-77195989 GGGCTTGGCCAGCCTGGGCTTGG + Intronic
1120173888 14:81273619-81273641 GGGCTGGGCCAGGCTGGGCTGGG + Intronic
1120222742 14:81753147-81753169 GGGCTGGGACAGCGGGAGATGGG - Intergenic
1121029060 14:90642504-90642526 GGGCAGGGACTGCTTGGGGTTGG - Intronic
1122254032 14:100463747-100463769 GGGATGGGTCAGCCTGCAGAAGG - Intronic
1123084429 14:105711049-105711071 GGGCTGGGACGGGCTGGGCTGGG - Intergenic
1123084500 14:105711264-105711286 GGGCTGGGACAAGCTGGGCTGGG - Intergenic
1123095590 14:105765654-105765676 GGGCAGGGACATCCTGCTGAGGG + Intergenic
1125594157 15:40873754-40873776 GGGCGGGGAGAGCCTGAGTTAGG + Intronic
1127309590 15:57740333-57740355 AGGCAGGGCCAGCCTGGGGTGGG - Intronic
1128340789 15:66821320-66821342 GGGCTGGGACAGCTGGAGGAAGG + Intergenic
1129034633 15:72641840-72641862 GGGCTGGGCCAGCCTGAGGTTGG - Intergenic
1129215249 15:74095376-74095398 GGGCTGGGCCAGCCTGAGGTTGG + Intergenic
1129539750 15:76340194-76340216 GGGCTGGGCCACCCGGAGGTTGG + Intronic
1129670556 15:77605614-77605636 GGGCCAGGACAGCCTGTGATGGG - Intergenic
1129732396 15:77939721-77939743 GGGCTGGGCCAGCCTGAGATTGG + Intergenic
1129771561 15:78206368-78206390 GGGCAGGGACAGGCTGAGGAAGG - Intronic
1129780717 15:78268904-78268926 GGGCTGGGAGGGTCTGAGGTGGG + Intronic
1131423459 15:92326443-92326465 GGGCCGGGACAGCCTGGCTTAGG + Intergenic
1131507068 15:93028537-93028559 AGGGTGGCACAGCCTGCGGGCGG + Intergenic
1132368687 15:101277525-101277547 GGGCGGGGTCGGCCTGCGATTGG - Intergenic
1132414542 15:101610994-101611016 GGGCGGGGGCAGCCTTGGGTAGG - Intergenic
1133239397 16:4405420-4405442 GGGCTGGGACCCCCTGGGCTGGG - Intronic
1134441546 16:14302164-14302186 GGGCTGGGCCGGCCCGGGGTTGG - Intergenic
1134654383 16:15937036-15937058 GGCCTGGGACAGCCTGGGCCTGG - Intergenic
1136172211 16:28496072-28496094 AGGCTGGGACAGCCTCAGGAGGG + Exonic
1136569752 16:31089492-31089514 GGTCTGGGCCAGCCTGAGTTAGG - Intronic
1137600321 16:49752037-49752059 GGGCCAGGAGAGCCTGGGGTGGG - Intronic
1138180560 16:54937835-54937857 CGGCTGAAACAGCCTGCGGGTGG + Intergenic
1138337177 16:56262297-56262319 GGGCTCTGACAGCCTGTGGGAGG - Intronic
1138352586 16:56353857-56353879 GGGTTGGGACAGCCTTGGGTGGG - Intronic
1138492573 16:57384816-57384838 GGGGTGGGACACCCTGTGATGGG + Exonic
1138584404 16:57960745-57960767 GGGTGGGGACAGCCTGCTGGAGG + Intronic
1139395433 16:66634960-66634982 GGGCTGTGAAACCCTGCGGGAGG - Intronic
1139403141 16:66697323-66697345 CGGCGGGGACAACCTGCAGTGGG - Intergenic
1139504748 16:67393270-67393292 CGGCTGGGACCGCCGGAGGTTGG + Intronic
1141430033 16:83966597-83966619 GGCCTGGGACAGGCTGCGGAGGG - Intergenic
1141639541 16:85333370-85333392 GGGCTGGGCCAGCACGGGGTGGG - Intergenic
1141699696 16:85636695-85636717 GGGCTGGGAGAGCCGCCGTTAGG + Intronic
1142006789 16:87693029-87693051 GGGCCGGGCCAGCCTGCAGGGGG - Intronic
1142048092 16:87939009-87939031 GGGCTGGCAATGCCTGGGGTGGG - Intergenic
1142154178 16:88525773-88525795 GGGCTGGGACAGGGCGAGGTGGG - Intronic
1142365823 16:89649167-89649189 GGGCTGGATCAGCGTGGGGTGGG - Intronic
1142614449 17:1126399-1126421 GGGCTGGGGCCGCCAGCGGGGGG + Intronic
1142852900 17:2712697-2712719 GGGCTGGGAGGGCCTTAGGTAGG + Intergenic
1148200837 17:45749121-45749143 GGGGTGGGACAGCCAGGGCTTGG + Intergenic
1148720555 17:49749762-49749784 GGGCTGGGACACACGGCAGTGGG + Intronic
1149658691 17:58323590-58323612 GGGCTGGGGCAGGCTGCCCTGGG - Intronic
1150442721 17:65204153-65204175 GGCCAGGAACAGCCTGGGGTGGG - Exonic
1151704530 17:75759638-75759660 GGGCAAGGACAGGCTGGGGTGGG + Intronic
1151828742 17:76537747-76537769 GGCGGGGGACAGCCAGCGGTGGG + Exonic
1152093103 17:78257748-78257770 GGGTGGGGCCAGCCTGCGTTGGG - Intergenic
1152190385 17:78884282-78884304 GGGCTGCGACAGCGCGAGGTGGG + Intronic
1152320104 17:79603926-79603948 GTGCAGGGACAGCCTGAGGCCGG - Intergenic
1158023443 18:52869770-52869792 GGGCTGTGACAGCCCGGGCTTGG + Intronic
1160075127 18:75667401-75667423 GGGCTGGCAAAGCCTGCAGGAGG + Intergenic
1160682505 19:418207-418229 GGGCTGGGACAGGCAGGGGCTGG - Intronic
1160740939 19:685602-685624 GGGGTGGGACGGGCAGCGGTGGG - Exonic
1161009650 19:1954143-1954165 GGCCTAGGTCAGCCTGAGGTTGG + Intronic
1161390437 19:4017610-4017632 GGGAGGGGACAGCCTGGGGAGGG + Intronic
1161420326 19:4173108-4173130 GGGCTGGGCCAGCCTGGGATGGG + Intergenic
1161561027 19:4972488-4972510 GGGCTGGGACATTCTGTGGCGGG + Intronic
1161574058 19:5046165-5046187 GGGCTGGCACAGCCTGCGTGCGG - Intronic
1162449765 19:10747749-10747771 GGGCAGGGACAGACTGCAGCTGG + Intronic
1162721313 19:12664583-12664605 GAGCTGGGTCAGCCTGGGCTGGG + Intronic
1164734226 19:30528944-30528966 GGGCAGAGACAGCCTGGGATAGG + Intronic
1165428127 19:35756742-35756764 GGTCTGGGGCAGCCTGGGGTGGG - Intronic
1165459581 19:35936631-35936653 GGGAGGGGACCGGCTGCGGTGGG - Intronic
1165613763 19:37180014-37180036 GGGTTCAGACAGCCTGCAGTTGG - Intronic
1165761945 19:38326753-38326775 GGGCTGGGACCCCCGGCGGGCGG + Exonic
1165938065 19:39401537-39401559 GGGCTGAGTCAGCCTGTGATGGG - Intergenic
1166107833 19:40606100-40606122 GTGCAGGGACAGCCTTAGGTTGG - Intronic
1166228803 19:41413701-41413723 GGGCTGGGACATACAGTGGTAGG - Intronic
1166915171 19:46190629-46190651 GGGCTGGGAGGGTCTGTGGTAGG - Intergenic
925050417 2:810497-810519 GAGCTGGGAAAGCCTGCTGCAGG + Intergenic
927918223 2:26950141-26950163 GCGCAGGCACAGCCTGGGGTCGG + Exonic
931693945 2:64858459-64858481 GGGCTGGGGCTGCTGGCGGTTGG - Intergenic
932105358 2:68936724-68936746 AGGCTGGGGCAGGCTGTGGTGGG - Intergenic
933948564 2:87308934-87308956 GGGCGGGGACAGGCTGGGGGTGG + Intergenic
936331635 2:111552661-111552683 GGGCGGGGACAGGCTGGGGGTGG - Intergenic
938091498 2:128437505-128437527 GGGCTGGGGCTGGCTGCTGTGGG + Intergenic
938246535 2:129781664-129781686 GGGACGGGACAGGCTGCGGGAGG - Intergenic
939659063 2:144865108-144865130 GGGCTGGGATAGGATGAGGTGGG + Intergenic
943209628 2:184946982-184947004 GGGCTGGGACATTTTGAGGTAGG + Intergenic
944495800 2:200306637-200306659 GGGCGGGGGCAGCCTGCGAGGGG + Intronic
944597210 2:201271877-201271899 GAGCTGGGAAAGACTGCGGTGGG + Intronic
944715860 2:202376033-202376055 GGGCTGGGTGGGGCTGCGGTGGG - Intergenic
947047899 2:226008938-226008960 TGGCTGGGACAGTCTGTGGCTGG + Intergenic
947474603 2:230431385-230431407 GTGCTGTGCCAGCCTGGGGTAGG + Intronic
948454198 2:238097159-238097181 GGGCTGGGGCGGGCTGGGGTGGG + Intronic
948498365 2:238370558-238370580 GGGGTGGGAGAGCCCGGGGTAGG - Intronic
948591463 2:239053417-239053439 GGGCTGGGTGAGCCTGCAGGCGG + Intronic
948866908 2:240780203-240780225 GGGCTGGGAGAAACTGCGGGGGG - Intronic
949036697 2:241818741-241818763 GGGCTGAGGCTGCCTGAGGTGGG - Intergenic
1169119335 20:3085623-3085645 GGGGTGGGAGAGCCGGGGGTGGG + Intergenic
1171244959 20:23603486-23603508 AGCCTGGTACAGCCTGCTGTGGG + Exonic
1172765147 20:37346793-37346815 GGACTGGGCCAGACTGCGTTTGG + Intronic
1175860378 20:62147309-62147331 GTGCTGGGGAACCCTGCGGTGGG + Intronic
1175894072 20:62328351-62328373 GGGCTGGCACAGCAGGCAGTCGG + Exonic
1175943933 20:62550184-62550206 GGGCAGGGACAGCCGGTGGGAGG + Intergenic
1178422071 21:32451078-32451100 GGGCTGAGCCAGCCTGCCCTGGG - Intronic
1179272917 21:39865567-39865589 GGGCTGCAGCAGCCTGAGGTTGG - Intergenic
1179517518 21:41918784-41918806 GTGTTAGGACAGTCTGCGGTGGG - Intronic
1179939846 21:44630142-44630164 GGGCAGGGGCATCCTGTGGTGGG + Intronic
1180010892 21:45050550-45050572 GGGCTGGGACATCCTGGGGACGG - Intergenic
1180014260 21:45072601-45072623 AGGCCCGGCCAGCCTGCGGTGGG + Intergenic
1180037502 21:45257313-45257335 GGGCAGGGACAGCGTGTGGCAGG + Intergenic
1180052199 21:45336304-45336326 GGGCTGGCACAGGCTGGGGAGGG - Intergenic
1180154985 21:45973295-45973317 GGGCCGGGCCTGCCTGCGGCGGG + Intergenic
1180155284 21:45974526-45974548 GGCCGGAGGCAGCCTGCGGTTGG - Intergenic
1180198914 21:46213296-46213318 GGGCTGGCACAGCCTGGGGTCGG - Intronic
1181534079 22:23532881-23532903 GGGCAGAGACAGCCTGGGGAAGG + Intergenic
1181573899 22:23782128-23782150 AGGCTGGGAGAGTCTGTGGTAGG + Intronic
1181582975 22:23838060-23838082 GGGCAGGGACAGGCAGTGGTTGG - Intronic
1182808976 22:33099674-33099696 GGGCTTGGACAGCTTGAAGTTGG + Intergenic
1182903804 22:33920291-33920313 GGCCTGGGTCAGCCTCGGGTTGG + Exonic
1183479879 22:38057611-38057633 GGGATGGGACAGTCTCCGGGTGG - Intronic
1183521325 22:38297723-38297745 GGGCCAGGACAGCCTGAGGGAGG - Intronic
1183614722 22:38937028-38937050 GGGCTGGGACACCCTGACTTTGG - Intergenic
1183723944 22:39578207-39578229 GGGCAGGGACAGCAGGCGATGGG - Intronic
1183806547 22:40216266-40216288 GGGCTGGGAGTGCATGCGGTCGG - Intronic
1183986933 22:41575225-41575247 GAGCTGCGAGAGCCTGCGCTGGG + Exonic
1184072962 22:42157527-42157549 GGGCAGGGCCAGCCTGCAGGGGG + Intergenic
1184727556 22:46355658-46355680 GGGATGGGAGACCCTGGGGTAGG + Intronic
950522823 3:13506681-13506703 GGTCTGGGACAGCCTGGGAATGG + Intergenic
953607291 3:44420163-44420185 GGGCTGGTGCAGCCTGCTGAGGG + Intergenic
954115551 3:48465181-48465203 GTGCTGGAACAGGCTGCAGTGGG - Intronic
954636487 3:52073691-52073713 GTCCTGGGACAGCCTGACGTGGG - Intergenic
954671627 3:52294207-52294229 CGGCGGGGACAGCCAGCGGAGGG - Intergenic
954751817 3:52818166-52818188 GGGCTGGGACAGCCGGGGCACGG + Exonic
954759257 3:52862045-52862067 AGACTGGGCCAGCCTGCAGTTGG - Intronic
955518865 3:59754978-59755000 GGTCTGGGGCAGCCTGGGTTTGG + Intronic
957048559 3:75394966-75394988 GGGCTGAGCCAGCCTGCCCTGGG + Intergenic
957865050 3:86012532-86012554 GGGCTGGGCCAGCCAGCGGGCGG + Intronic
961268758 3:125671747-125671769 GGGCTGGGCCAGCCCGCACTTGG + Intergenic
961398584 3:126616626-126616648 GGGCTGGGCCTGCCTGCATTTGG - Intronic
961469954 3:127105382-127105404 GGGCTGGGGCAGCCTCCATTGGG - Intergenic
961793672 3:129394177-129394199 TGGGTGGGACAGCCTGTGGACGG + Intergenic
961819037 3:129565861-129565883 AGGCTGTGACAGACTGGGGTGGG - Intronic
961880636 3:130059079-130059101 GGGCTGAGCCAGCCTGCCCTGGG + Intergenic
966914742 3:184578485-184578507 GGGCTGGGAGAGCTTGGGGAGGG - Intronic
967018623 3:185503434-185503456 GGGCTGCTGCAGCCTGCGGGAGG - Intergenic
968454286 4:689194-689216 GGGCCGGGACCGCCTGCGGGCGG + Exonic
968502509 4:957480-957502 GGGCAGGACCAGCCTGCTGTGGG - Intronic
968547989 4:1208288-1208310 GTGCAGGGCCAGCCTGGGGTGGG + Intronic
968615199 4:1574652-1574674 GGGCTGGGACAGAGTGGGGCTGG - Intergenic
968662681 4:1805269-1805291 GGGCTGGGCCAGGCTGGGGTGGG + Intronic
968993025 4:3927423-3927445 GGGCTGAGCCAGCCTGCCCTGGG + Intergenic
969298164 4:6281584-6281606 GTGGTGGCACAGCCTGAGGTAGG + Intronic
969822443 4:9730939-9730961 GGGCTGAGCCAGCCTGCCCTGGG - Intergenic
975221257 4:71814816-71814838 GGGCTGTGACAACCTGTGCTTGG + Intergenic
976311900 4:83621223-83621245 GGGACGGGACAGCCTGGTGTGGG - Intergenic
976928649 4:90534417-90534439 AGGCTGGCACAGCCTGGGCTCGG - Intronic
982289618 4:153766515-153766537 GGCCTGGGACAGCCTGGGGAGGG - Intergenic
983021019 4:162675525-162675547 GGGCTGGGAGAGCATGAGCTAGG + Intergenic
984034946 4:174654863-174654885 AGGCTGGGACAGTGTGGGGTGGG + Intronic
990323061 5:54648665-54648687 TGGCTCGGGCAGCCTGCGTTTGG + Intergenic
992891250 5:81206429-81206451 GGGCAGGGAAAGCCCACGGTAGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997642229 5:135456735-135456757 TGGCTAGGACAGCCTCTGGTTGG + Intergenic
997733880 5:136199564-136199586 GGTCTGGGCCAGCCTGCGGCGGG + Intergenic
999144026 5:149380980-149381002 GGGCTGGGACAGCCTGCGGTGGG - Intronic
999235253 5:150086696-150086718 GGGCAGGGCCAGCCTGAGCTTGG + Intronic
1001230539 5:169983668-169983690 GGGCAGGAACAGCCTGGGCTGGG - Intronic
1001955108 5:175843621-175843643 GGGCTGAGAAAGCCTTGGGTCGG + Intronic
1002355634 5:178626904-178626926 GTGCTGGGACAGGCGGCTGTCGG - Intronic
1006375294 6:33668489-33668511 GGGTGGTGACAGCCAGCGGTGGG - Intronic
1006617898 6:35342408-35342430 GGCCCGGGGCAGCGTGCGGTGGG + Intergenic
1006912983 6:37576084-37576106 GGGCTGGGCCAGGCTGGGGCTGG + Intergenic
1006912988 6:37576100-37576122 GGGCTGGGCCAGGCTGAGGCTGG + Intergenic
1007345753 6:41228420-41228442 GGGCTGGAATGGCCTGGGGTGGG + Exonic
1007474004 6:42107212-42107234 GGGCTGGCACAGGAGGCGGTGGG + Exonic
1007755520 6:44096738-44096760 GGCCAGGCACAGCCTGCTGTAGG - Intergenic
1012248390 6:96952901-96952923 GTGCTGGGACAGCCTCTGGGTGG - Intronic
1017708497 6:157146397-157146419 GGGCTGGGAGAGCCTGCAGCTGG - Intronic
1018166122 6:161098559-161098581 GGGCCGTGACAACCTGCGGAAGG - Intronic
1018220092 6:161569401-161569423 GAGTTGGGACAGCCAGCTGTTGG + Exonic
1018619230 6:165714548-165714570 GGGCTGGGGCAGCCAGGGGAGGG + Intronic
1018920341 6:168168066-168168088 GGGCTGGGTCATCCTGGGGTGGG + Intergenic
1018942630 6:168319579-168319601 GGGCTGGGACCGCCGTAGGTTGG - Exonic
1019164269 6:170087952-170087974 GGACCGGGAGACCCTGCGGTGGG + Intergenic
1019379275 7:712631-712653 GGGCGGGGAGAGCCGGGGGTGGG - Intronic
1019412486 7:912332-912354 AGGCGGGGCCAGCCCGCGGTGGG + Intronic
1019641353 7:2105450-2105472 GGGCGGGCACAGCCTGCGCTGGG + Intronic
1019707527 7:2503662-2503684 TGGCTGGCACAGGCTGCGCTGGG + Intergenic
1019713723 7:2529091-2529113 GGGCTGGGACCAGCTGCAGTGGG - Intronic
1020107835 7:5430351-5430373 GGGGTGGGACAGCCTGGATTTGG - Intergenic
1020315666 7:6903768-6903790 GGGCTGAGCCAGCCTGCCCTGGG + Intergenic
1022923416 7:35037676-35037698 GGGCGGGGACACCCTGCGAGCGG + Intronic
1023742801 7:43295540-43295562 GGCCTGGATCAGCCTGCTGTTGG + Intronic
1035468667 7:159096174-159096196 GGGCTTGGGCAGCCTTGGGTGGG - Intronic
1035582312 8:747811-747833 GGGATGGGCGGGCCTGCGGTGGG + Intergenic
1035582357 8:747931-747953 GGGATGGGCGGGCCTGCGGTGGG + Intergenic
1035582373 8:747971-747993 GGGATGGGCGGGCCTGCGGTGGG + Intergenic
1036823172 8:11955771-11955793 GGGCTGGGGGAGCCGGCGGAGGG + Intergenic
1037812758 8:22096626-22096648 GTGCTGGGCCAGGCTGAGGTGGG + Intronic
1039968924 8:42305291-42305313 GGACTGGGAAAGCCTCAGGTGGG + Intronic
1040537621 8:48323494-48323516 GCGATGGCCCAGCCTGCGGTTGG + Intergenic
1041787752 8:61654481-61654503 GTGCATGGACAGCCTGCGGCAGG + Intronic
1045062614 8:98422675-98422697 GGGCAGGGCCTGCCTGCGGTGGG - Intronic
1045111887 8:98944432-98944454 GGCCTGGGGCAGCCTGGGGAGGG + Exonic
1045245034 8:100435360-100435382 TGGCTGGGGCAGCCTGAGATGGG + Intergenic
1045285272 8:100785300-100785322 GGGGAGGGACAGGCTGTGGTGGG - Intergenic
1045323665 8:101101035-101101057 GAGCTGGGAGAGCCTGAGGGAGG - Intergenic
1048766199 8:137847167-137847189 GGGCGGGCACAGCCTGCAGAAGG + Intergenic
1049244727 8:141556224-141556246 GTCCTGGGCCAGCCTGCTGTGGG - Intergenic
1049310550 8:141931597-141931619 GGGCAGGGACAGCCTCTGGGTGG + Intergenic
1049367246 8:142246375-142246397 GGGCAGGGACAGCCAGCAGCAGG - Intronic
1049426482 8:142540198-142540220 GAGCTGGGACAGCCCCAGGTGGG + Intronic
1049612398 8:143561648-143561670 GGGCTGTGACGGCCTGGGGAAGG + Intronic
1049757724 8:144318223-144318245 GGGCTGGGGCTGCCTGCTGGGGG - Intronic
1050754031 9:8977827-8977849 GGGCTGGGAAAGACTGAGGGAGG + Intronic
1057125694 9:92614265-92614287 GGGCTGGGGCAGCCTGGTTTGGG - Exonic
1057489669 9:95511207-95511229 GGGCGGGGAGAGCCGGCGGACGG - Intronic
1057569658 9:96194769-96194791 GGGCTGGGAAAGGCCGAGGTAGG + Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1060192896 9:121604152-121604174 GGGCTGAGAGGGCCTGCAGTGGG - Intronic
1060819260 9:126652002-126652024 GGGGGGGGCCTGCCTGCGGTGGG + Intronic
1060921303 9:127422445-127422467 GGGTGGGGACAGCCTGAGGCTGG + Intergenic
1060945673 9:127568473-127568495 GGGCGGGGACAGCCAAGGGTGGG + Intronic
1062102656 9:134736584-134736606 GGGCTGGGACAGAATGTGCTAGG - Intronic
1062335035 9:136061265-136061287 AGGCTGGGGCAGCCTGGGTTTGG - Intronic
1062400930 9:136372325-136372347 GGGCTGGGAAAGGCTGCGGAGGG - Intronic
1062540322 9:137039176-137039198 GGGCTGGGCCAGCCCAGGGTTGG - Intergenic
1062685906 9:137813313-137813335 GGGGTGGCACAGCGTGCAGTGGG - Intronic
1185641628 X:1591958-1591980 GGGCTGGGGAGGTCTGCGGTCGG + Intronic
1189280773 X:39818937-39818959 GGGCGGGAACAGCCTGGGGAGGG + Intergenic
1189322011 X:40092425-40092447 TGGCGGGGACAGCCTGTGTTGGG - Intronic
1189440526 X:41031779-41031801 GGGATGGGACAGCCTGGGAAGGG - Intergenic
1192544804 X:72004591-72004613 GGGCTGTGGGAGCCTGAGGTCGG + Intergenic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1195915688 X:109932931-109932953 GGGCTGGGTCAACCTGGGGTAGG - Intergenic
1197717077 X:129717317-129717339 GAGCTGGGACAGCCTGGGTTGGG + Intergenic
1199881015 X:151974423-151974445 GGACTCGGCCAGCCCGCGGTAGG + Intronic
1199973579 X:152878033-152878055 GGCCTGGGACTGCCTGAGGATGG + Intergenic