ID: 999145623

View in Genome Browser
Species Human (GRCh38)
Location 5:149391369-149391391
Sequence ATGGAGAACCTCAGCCACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999145611_999145623 30 Left 999145611 5:149391316-149391338 CCAGCCTGTCGGGACTGGGAAGA 0: 1
1: 0
2: 2
3: 9
4: 137
Right 999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG 0: 1
1: 0
2: 1
3: 33
4: 204
999145618_999145623 -8 Left 999145618 5:149391354-149391376 CCCAGGCTTAGAGGCATGGAGAA 0: 1
1: 0
2: 1
3: 23
4: 203
Right 999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG 0: 1
1: 0
2: 1
3: 33
4: 204
999145612_999145623 26 Left 999145612 5:149391320-149391342 CCTGTCGGGACTGGGAAGAGCAG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG 0: 1
1: 0
2: 1
3: 33
4: 204
999145619_999145623 -9 Left 999145619 5:149391355-149391377 CCAGGCTTAGAGGCATGGAGAAC 0: 1
1: 0
2: 3
3: 10
4: 132
Right 999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG 0: 1
1: 0
2: 1
3: 33
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999145623 Original CRISPR ATGGAGAACCTCAGCCACGG GGG Intronic
900108409 1:995889-995911 CTGGAGAACCTCAGTCCCTGTGG - Intergenic
901418873 1:9136853-9136875 ATGGAGAAGGCCAGGCACGGTGG - Intergenic
901674247 1:10873633-10873655 ATGGAGAAACTAAGGCACAGTGG + Intergenic
903682357 1:25105528-25105550 ATGGAGAAACTGAGCCACATGGG + Intergenic
904267801 1:29327588-29327610 ATGGAGAAACTGAGGCACAGAGG - Intergenic
905891414 1:41520809-41520831 AGGGAGAACCTCAGCCTGGCGGG - Intronic
907052923 1:51341978-51342000 ATGGAGAGGCCCAGCCAAGGAGG - Intronic
907752777 1:57279440-57279462 ATGCAGAACCTCAGATATGGAGG + Intronic
909757034 1:79239744-79239766 ATGGAGAACCACTGCTAGGGTGG - Intergenic
910275200 1:85442199-85442221 ATGGAGAACATCACACACTGGGG - Intronic
910347407 1:86255744-86255766 ATGGAGCCCCTCAGCCAGAGTGG - Intergenic
910414322 1:86981913-86981935 ATGGAGAACCTCTGCTAGGACGG - Intronic
911788312 1:101979673-101979695 ATGGAAAACCTCTGCTAGGGCGG + Intronic
911823413 1:102448037-102448059 AAGGGGAACATCACCCACGGGGG + Intergenic
912809463 1:112782969-112782991 ATGGAGAACCTCTACTAGGGTGG - Intergenic
913040142 1:115014220-115014242 AAGGAGAACCTCACACACCGGGG - Intergenic
914230537 1:145761662-145761684 ATGGAGAACCTCTGCTAGGGCGG + Intronic
915279390 1:154812126-154812148 ATTGAGAACCGCTGCCACGGGGG + Intronic
916992646 1:170260969-170260991 ATGGGGAACATCACACACGGGGG + Intergenic
917165372 1:172106637-172106659 ATGGAGAATCTCAGATACAGAGG - Intronic
917359291 1:174159207-174159229 CTGGAGAACCTCCGCGGCGGAGG - Intergenic
918614035 1:186523922-186523944 ATGGAGGACCTCTGCTAGGGTGG + Intergenic
920464456 1:206170021-206170043 ATGAGGAAACTCAGACACGGAGG - Intergenic
922402112 1:225270292-225270314 ATGGGGAACCTCACACACCGGGG + Intronic
922767320 1:228162823-228162845 AAGGAGAACAGCAGCCAGGGTGG + Intergenic
923417978 1:233783653-233783675 ATGGAGAATCTCATCAACAGGGG - Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1067894408 10:50163489-50163511 GTGGAGAAACTGAGCCACAGAGG + Intergenic
1067954435 10:50776772-50776794 GTGGAGAAACTGAGCCACCGAGG - Intronic
1070666992 10:78351973-78351995 ATGGAGAAGCTCAGCCAAACTGG - Intergenic
1075411961 10:122234918-122234940 ATGGAGAATCTCAGAGACTGGGG - Intronic
1077791526 11:5446075-5446097 AAGGGGAACATCAGCCACTGGGG + Intronic
1078193189 11:9110436-9110458 ATGGAGAAACTCAGGAACTGTGG - Intronic
1079500244 11:21094518-21094540 ATGGAGAGCCTCTGCTAGGGCGG - Intronic
1083506292 11:63160531-63160553 ATGGAGAACCTCTGCTTGGGCGG + Intronic
1087313380 11:96577140-96577162 ATGCACAAGCTCAGCCACTGTGG - Intergenic
1092119835 12:6036239-6036261 ATGGAGAAACACAGGCACGGAGG + Intronic
1094844811 12:34356783-34356805 ATGGAGCACCTCAGCCCACGAGG - Intergenic
1094848324 12:34371194-34371216 ATGGAGCACCTCAGCCCACGGGG - Intergenic
1097157063 12:57020017-57020039 AAGGAAACCCTAAGCCACGGTGG - Intronic
1100054337 12:90490833-90490855 ATGGAGAACCTCTGCTAGGGTGG + Intergenic
1101761852 12:107665177-107665199 AAGGAGAACATCAGACACTGGGG + Intergenic
1102242859 12:111336108-111336130 GTGGAGAACCCCAGTCACTGCGG + Intronic
1102248865 12:111372230-111372252 ATGGAGAACCTCTGCTAGGGTGG - Intergenic
1103973496 12:124687117-124687139 AGAGAGAACCTCAGGCCCGGAGG - Intergenic
1105205722 13:18221837-18221859 ATGGAGAACATCAGCCCTGCAGG - Intergenic
1107973903 13:45671117-45671139 ATGGGGAACTTCACCAACGGAGG + Intergenic
1110585154 13:77181696-77181718 ATGGAAAAACTCAGCCAGGTAGG - Exonic
1112635403 13:101212107-101212129 ATGGAGAATCACAGGCATGGAGG - Intronic
1114798122 14:25739944-25739966 CTGGAGAACCTCAGCTAGGGTGG - Intergenic
1114889721 14:26903489-26903511 ATGCTGAACATCAGCCACAGGGG - Intergenic
1114986753 14:28239040-28239062 ATGGAGAACCTCTACTAGGGCGG + Intergenic
1116302155 14:43196599-43196621 ATGGAAAACCACAGACACTGGGG + Intergenic
1116388649 14:44364405-44364427 ATGGACAACCTAAGTCAGGGGGG - Intergenic
1116917270 14:50537392-50537414 ACGGAGAACCTCTGCTAGGGTGG + Intronic
1117342280 14:54802799-54802821 ATTGAGAACCACAGCCATGTCGG - Intergenic
1118069622 14:62231941-62231963 ATGGAGAACCTCTGCTAGGGCGG + Intergenic
1118151449 14:63194997-63195019 ATGGAGAACCTCTGCTAGGGCGG + Intergenic
1118400133 14:65372230-65372252 ATGGAGATCCTCATCCACCTTGG + Intergenic
1119040400 14:71269502-71269524 ATGGAGAACCTCTGCTAGGGTGG + Intergenic
1119991411 14:79202160-79202182 AGGGAGAACATAAGCCACAGAGG - Intronic
1121722759 14:96122374-96122396 AAGCAGAACCTCAGATACGGGGG + Intergenic
1123016192 14:105376849-105376871 ATGGAGCACCCCAGCGACAGCGG + Exonic
1123030074 14:105447435-105447457 GAGCAGAACCTCAGCCAAGGGGG - Intronic
1128108662 15:65062469-65062491 ATGGAGACCCTCAGGCACAAAGG - Intronic
1129335643 15:74850709-74850731 TTGGAGCCCCTCAGCCACTGTGG - Intronic
1132440888 15:101863167-101863189 ATGGAGAACCTCTGCTAAGGCGG + Intergenic
1134132582 16:11659522-11659544 ATGGAGAAACTCAGGCTCAGCGG + Intergenic
1136930129 16:34410954-34410976 TTGTAGAGCCTCAGCCACCGAGG - Intergenic
1136974445 16:35000851-35000873 TTGTAGAGCCTCAGCCACCGAGG + Intergenic
1137574990 16:49593636-49593658 ATGGAGAAACAAAGGCACGGAGG - Intronic
1139311874 16:66034349-66034371 ATGGAGGAACTGAGCCATGGAGG + Intergenic
1140020140 16:71230635-71230657 ATGGAGCCCCTCAGCGGCGGCGG - Exonic
1141352073 16:83307186-83307208 CTGGTGTTCCTCAGCCACGGGGG - Intronic
1141719253 16:85746554-85746576 ATGGAGGTCCTGAGTCACGGTGG + Intronic
1142285456 16:89169793-89169815 AAGGAGAAACTGAGGCACGGGGG + Intergenic
1142623652 17:1179705-1179727 ATGGAGCCGCTCAGCCACCGGGG - Exonic
1143283382 17:5771462-5771484 AGGGGGAAGCTCAGGCACGGCGG - Intergenic
1143537566 17:7550253-7550275 AGGGAGAAACTGAGGCACGGAGG + Intronic
1143953801 17:10653604-10653626 CTGGAGGACCTCAGGCACAGGGG + Intronic
1146697388 17:34920075-34920097 ATGGAGAACCTCTGCTAGGATGG + Intergenic
1151214890 17:72570732-72570754 ATGGAGAACCTCACCAAAGGTGG + Intergenic
1152365700 17:79855155-79855177 ATGGAGAAACTGAGGCACAGGGG - Intergenic
1152741930 17:82022265-82022287 GTGGAGAAACTGAGGCACGGGGG - Intronic
1152887724 17:82862319-82862341 CTGGAGAGCCTCAGCCTCTGTGG + Intronic
1155283026 18:24260221-24260243 ATGTAAAACGTCAGCCACTGCGG + Intronic
1160138403 18:76295798-76295820 ATGCAGCAGCTCAGCCATGGGGG - Intergenic
1160316043 18:77848791-77848813 AAGGAGAACATCACACACGGGGG + Intergenic
1160601333 18:80014792-80014814 ATGGAGAACCTCTGCTAGGGTGG - Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1164324356 19:24178999-24179021 ATAAATAAACTCAGCCACGGGGG + Intergenic
1165267861 19:34676947-34676969 ATGGAGACCCTCATCCTGGGAGG - Intergenic
1167371473 19:49085281-49085303 CTTGAGTACCTCAGCCGCGGGGG - Intergenic
1167403495 19:49288699-49288721 ATGCAGAACCTCTGCCAGGGAGG + Intergenic
1167660250 19:50792067-50792089 ATGGGGAACCTCAGCAGCTGGGG - Exonic
925716450 2:6788387-6788409 ATGGGGATCCTGAGCCAGGGAGG + Intergenic
925942367 2:8833227-8833249 ATGGGGAAACTCAGACACTGAGG - Intronic
926225001 2:10961206-10961228 GCGGGGAACCTCAGCCCCGGAGG - Intergenic
926692270 2:15745753-15745775 ATGGAGAAACTGAGGCACAGAGG + Intergenic
927360216 2:22223975-22223997 ATGGAGAACCTCTGCTAGGAGGG + Intergenic
927848762 2:26485896-26485918 CTGGAGAACCTCAGCCAGGCTGG + Intronic
929763792 2:44827625-44827647 TTGGAGAATCTCAGACAGGGAGG + Intergenic
930250047 2:49024872-49024894 ATGGAAATCCTCAACCACTGGGG - Intronic
930558475 2:52929765-52929787 ATGGAGAACCTCTGCTATGGTGG - Intergenic
935106981 2:100053974-100053996 ATGGAGAACTGCAGCCATTGGGG - Intronic
937560573 2:123219140-123219162 GTGGACCACCTCAGCCACAGGGG + Intergenic
938577846 2:132620547-132620569 GTGGAGCACCTGAGCCACGCAGG - Intronic
939288961 2:140168794-140168816 ATGAAGAAGACCAGCCACGGTGG + Intergenic
940487952 2:154320649-154320671 ATGGAGAAGGTCAGTCATGGAGG - Intronic
941225885 2:162848145-162848167 ATGGAGAACCTCTGCTTGGGTGG - Intergenic
941560310 2:167036110-167036132 ATGGAGAACCTCTGCTAGGGCGG + Intronic
943814215 2:192231068-192231090 ATGCAGAACAACAGGCACGGTGG - Intergenic
945162248 2:206904664-206904686 ATGGGGAACGTCACCCACTGGGG - Intergenic
947048719 2:226018537-226018559 ATGGAGAACCTCTGCTAGGGTGG - Intergenic
1173957941 20:47049037-47049059 ATGGAGAAACTGAGGCACAGAGG + Intronic
1174211999 20:48887200-48887222 ATGGGGAAACTGAGGCACGGAGG - Intergenic
1175474038 20:59256697-59256719 ATGGGGAACCATTGCCACGGAGG + Exonic
1175629752 20:60525645-60525667 ATGGAGAATCTCAAGCACAGAGG - Intergenic
1175912851 20:62412994-62413016 ATGGGGAAACTGAGGCACGGAGG + Intronic
1176674954 21:9769016-9769038 ATTGCGGACCTCAGCCACGGAGG + Intergenic
1177677055 21:24314583-24314605 ATGGACAACCTCACCAAAGGAGG + Intergenic
1177990492 21:28030313-28030335 ATGGAGAACTTCTGCTACGGCGG - Intergenic
1179603242 21:42495409-42495431 ATAGGGAACCTCAGCCACTATGG - Intronic
1179985490 21:44918523-44918545 ATGGGGAAACTGAGTCACGGGGG + Intronic
1180005052 21:45016809-45016831 ATGGAAGTCCTCAGCCAGGGAGG + Intergenic
1180760246 22:18196879-18196901 ATGGAGAACATCAGCCCTGCAGG + Intergenic
1180770558 22:18381177-18381199 ATGGAGAACATCAGCCCTGCAGG + Intergenic
1180775422 22:18427817-18427839 ATGGAGAACATCAGCCCTGCAGG - Intergenic
1180808492 22:18738872-18738894 ATGGAGAACATCAGCCCTGCAGG - Intergenic
1180828501 22:18884135-18884157 ATGGAGAACATCAGCCCTGCAGG + Intergenic
1181035494 22:20168063-20168085 TTGGACAACCCCAGCCACTGGGG - Intergenic
1181194494 22:21172786-21172808 ATGGAGAACATCAGCCCTGCAGG - Intergenic
1181214948 22:21319992-21320014 ATGGAGAACATCAGCCCTGCAGG + Intergenic
1181616695 22:24059950-24059972 CTGGAGAACCTAACCAACGGGGG + Exonic
1183649244 22:39144903-39144925 ATGGAGAAACTGAGACACGGAGG + Intronic
1183776906 22:39972167-39972189 ATGGAGAGCGACAGCCATGGTGG - Exonic
1184042609 22:41952931-41952953 AAGGAGCACCTCAGGCAGGGAGG - Intergenic
1184943901 22:47787557-47787579 ATGGAGAACCGCTGCTAGGGTGG + Intergenic
1185087047 22:48746590-48746612 ATGGAGAAACTGAGGCACAGGGG + Intronic
1203232393 22_KI270731v1_random:122349-122371 ATGGAGAACATCAGCCCTGCAGG + Intergenic
949439759 3:4067632-4067654 ATGGAGAGCCTCATCCACTCTGG + Intronic
950568433 3:13785643-13785665 CTGGAGATCCTGAACCACGGAGG - Intergenic
951457019 3:22904244-22904266 ATGGAGCTCCACACCCACGGTGG - Intergenic
955629764 3:60960606-60960628 ATGGAGAACATCACACACCGGGG - Intronic
956255800 3:67282222-67282244 AAGGAGAACATCACCCACTGGGG + Intergenic
957471839 3:80668557-80668579 ATGGAGAACTTCTGCTAGGGCGG + Intergenic
961782985 3:129332212-129332234 AAAGATAAACTCAGCCACGGGGG - Intergenic
965886876 3:173456933-173456955 ATAAAGAAACTCAGCCATGGAGG + Intronic
966972831 3:185061094-185061116 ATGGAGAACCTCTACTAGGGTGG + Intergenic
967271701 3:187738314-187738336 ATGGAGACCCTCAGCCCCTAGGG - Intronic
967453369 3:189652036-189652058 ATGGAGAACCTCTGGCAGAGTGG + Intronic
967509407 3:190292137-190292159 ATGGAGAACCTCTGCTACGGTGG - Intergenic
968893987 4:3388177-3388199 ATGGAGAGCCCCAGTCACAGAGG + Intronic
969530812 4:7729257-7729279 ATGGAGGACATTAGCCAGGGAGG + Intronic
969602096 4:8182620-8182642 ATGGGGAAACTGAGGCACGGAGG - Intronic
970864650 4:20744587-20744609 ATGGAGAACATCACACACGGGGG + Intronic
971518760 4:27521987-27522009 ATGGAAAACCTGAGTCACAGAGG - Intergenic
973225123 4:47775389-47775411 ATGGGGAACATCACACACGGGGG - Intronic
976881621 4:89932501-89932523 ATAGAGAACCTCTGCTAGGGTGG - Intronic
977417265 4:96749257-96749279 ATGGAGAACCTCTGCTAGGGTGG - Intergenic
978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG + Intergenic
979445653 4:120808708-120808730 ATGGGGAGGCTCAGGCACGGTGG + Intronic
980635630 4:135498251-135498273 AAGGAGAACCACAGACACTGGGG - Intergenic
980935200 4:139219573-139219595 ATGGAGAATCTCAGCTACTTGGG + Intergenic
981288183 4:143044743-143044765 AGGCAGAACCTCAGTCACGTGGG - Intergenic
981360514 4:143840270-143840292 ATGGAGACACTCAGCCTCTGCGG - Intergenic
981371281 4:143961335-143961357 ATGGAGACACTCAGCCTCTGTGG - Intergenic
984102892 4:175507682-175507704 AAGGAGAACCTCACACACCGGGG - Intergenic
984781982 4:183534231-183534253 ATGGACAACAGCAGCCTCGGAGG - Intergenic
985400600 4:189589679-189589701 ATTGCGGACCTCAGCCACGGAGG - Intergenic
986434078 5:7710722-7710744 ATGGAGAATCTTAGCAAGGGAGG + Intronic
990321459 5:54633572-54633594 ATGGAGAAACTGAGACACAGGGG - Intergenic
992295772 5:75325061-75325083 ATGGAGAACCTAACTCACAGTGG - Intergenic
993275355 5:85850237-85850259 ATGGAGAACCTCTACTAAGGCGG - Intergenic
993575169 5:89591276-89591298 ATAGAGAACCTCTGCTAGGGTGG + Intergenic
995627219 5:114092581-114092603 ATGGAGAAACTCTGCTAGGGTGG - Intergenic
999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG + Intronic
999482223 5:151959102-151959124 ATGAAGAAACTGAGCCACAGAGG - Intergenic
1000768316 5:165319056-165319078 ATGGAGAATCTCTGCCAGGGCGG - Intergenic
1001641920 5:173250340-173250362 AAGGAGAACATCAGCCAGGCGGG + Intergenic
1002699414 5:181111899-181111921 GTGCAGAACCTCAGCCCCAGGGG + Intergenic
1006447174 6:34086158-34086180 ATGGAGCACCCCATCTACGGAGG - Intronic
1007399987 6:41598019-41598041 ATGGGGAACCCCACCCAGGGTGG - Intronic
1009729333 6:67579364-67579386 ATGGAGAACCTCTGCTAGGTCGG + Intergenic
1009769127 6:68121957-68121979 ATGGAGAACCTCTGCTAGGGAGG - Intergenic
1010106087 6:72169819-72169841 ATGGATCACCTAAGCCAAGGAGG + Intronic
1010460935 6:76113546-76113568 ATGGAGAACATCACACACTGGGG - Intergenic
1011555752 6:88570106-88570128 ATGGAGAACCTCTACTAGGGTGG - Intergenic
1011910134 6:92425607-92425629 ATGGAGAACATCACACACCGGGG + Intergenic
1012811648 6:103966808-103966830 ATGGAGAACCTCTACTAAGGTGG - Intergenic
1013188967 6:107785835-107785857 CTGGAAAACCTCAGCCTCGTAGG - Intronic
1016106584 6:140171174-140171196 ATGGAGAACATCTGCTAGGGTGG - Intergenic
1018041024 6:159922274-159922296 ATGGAGAATCTCTGCAAGGGTGG + Intergenic
1018235027 6:161715772-161715794 ATGCAGAACCCCAGTCACTGGGG + Intronic
1018945419 6:168344558-168344580 ATGCAGAAACTCAGGCACTGGGG - Intergenic
1020095277 7:5365155-5365177 ATGGTGAACTCCAGCCAGGGTGG - Intronic
1021174956 7:17439924-17439946 ATGGAGATCCTCTGCTAGGGCGG - Intergenic
1022489662 7:30806882-30806904 ATGGAGGACCACAGCCACATGGG - Intronic
1022595971 7:31713602-31713624 ATGGAGAACCCCTGCTAGGGTGG - Intergenic
1023807726 7:43885769-43885791 ATGGAGAACTTCAGCTTGGGAGG - Intronic
1026742848 7:72989998-72990020 ATGGGGAACCACAGCCCCTGAGG + Intergenic
1026802700 7:73410388-73410410 ATGGGGAACCACAGCCCCTGAGG + Intergenic
1027028962 7:74874703-74874725 ATGGGGAACCACAGCCCCTGAGG + Intergenic
1027100887 7:75375080-75375102 ATGGGGAACCACAGCCCCTGAGG - Intergenic
1028360000 7:89955943-89955965 ATGGAGAACTTCTGCTAGGGTGG - Intergenic
1029214076 7:98932837-98932859 ATGCAGAACCACAGACACAGAGG + Intronic
1030162905 7:106526616-106526638 ATGGAGAACATCACACACTGGGG - Intergenic
1031583451 7:123505385-123505407 ATGGAGAACCTCTGCTAGGGTGG - Intronic
1031905574 7:127456910-127456932 ATGGGGAACATCACACACGGGGG + Intergenic
1033730255 7:144171371-144171393 ATGGAGAACCTCTGCTAGGGTGG + Intergenic
1034643170 7:152621038-152621060 ATGTGGAATCTCAGCCAGGGCGG + Intergenic
1034721617 7:153299309-153299331 AGGGAGAACCTCAGCATCGGGGG + Intergenic
1037069859 8:14630841-14630863 ATGGGGAACATCAGACACTGGGG + Intronic
1043458273 8:80433607-80433629 ATGGGGAACATCACACACGGGGG - Intergenic
1043623788 8:82229877-82229899 ATGGAGAACCTTTGCTAAGGTGG + Intergenic
1046400924 8:113702685-113702707 ATGGAGAACCTCTGCTAGGATGG - Intergenic
1046878162 8:119278567-119278589 ATGGAGAACCTCTCCTAAGGCGG - Intergenic
1048614707 8:136060078-136060100 ATGGATAAACTCAGCCACAGGGG - Intergenic
1051309814 9:15757991-15758013 ATAGAGAACCTCTGCTAGGGTGG + Intronic
1052980685 9:34446617-34446639 AGGGAGAACCAGAGCCATGGTGG - Intronic
1056516770 9:87359589-87359611 AGGTAGAAGCTCAGCCACAGTGG + Intergenic
1057164463 9:92914917-92914939 ATGGAGAGCCTCAGCCCCATGGG - Intergenic
1059045493 9:110861849-110861871 ATGGAAAACCTCTGCTAGGGTGG + Intergenic
1060743339 9:126113873-126113895 GGGGAGAAACTCAGCAACGGTGG + Intergenic
1060784984 9:126444168-126444190 ATGTAAAAACTCAGCCACTGAGG - Intronic
1187667379 X:21628446-21628468 ATGGAGAACCTCTGCTAGGGCGG - Intronic
1187675801 X:21715508-21715530 ATTGAGAACCACAGCCTAGGAGG + Intronic
1190011610 X:46789992-46790014 AAGGATCACCTCAGCCAGGGAGG + Intergenic
1192008553 X:67242803-67242825 ATGGAGAACCTCTGCTAGGGTGG + Intergenic
1192925862 X:75754443-75754465 ATGGGGAACATCACACACGGGGG - Intergenic
1193738638 X:85190937-85190959 ATGGGGAACATCAGACACCGTGG + Intergenic
1195545254 X:106106283-106106305 ATGGAGAACCTCTGTTAGGGTGG + Intergenic
1196758775 X:119181222-119181244 ATGGGGAACATCACCCACTGGGG + Intergenic
1197044177 X:121976233-121976255 ATGGAGAACCTCTGCTTCGTGGG - Intergenic
1197368800 X:125600602-125600624 ATGGAGAACCTCTGCTAGAGTGG + Intergenic
1199222567 X:145334315-145334337 ATGGTGAACCCCAGCAACAGTGG - Intergenic
1199820829 X:151443726-151443748 ATGGAGAACCTCTGCTAGGGTGG + Intergenic
1200340391 X:155389932-155389954 ATGGGTAACCTCAGCAAAGGAGG - Intergenic
1201387624 Y:13459766-13459788 AAGGACAACTTCAGCCACTGAGG - Intronic