ID: 999145820

View in Genome Browser
Species Human (GRCh38)
Location 5:149392872-149392894
Sequence GTGGTTGTTTCAGCCTTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999145820 Original CRISPR GTGGTTGTTTCAGCCTTAGA GGG (reversed) Intronic
904575029 1:31499941-31499963 GTGGTGGCTTCAGCCTGGGAGGG + Intergenic
907890553 1:58632627-58632649 GTAGTTGTTTGAGCCATAGTTGG - Intergenic
908826987 1:68142535-68142557 ATGGATGTTTGAGCCTTAGCTGG + Intronic
909056627 1:70828297-70828319 GTGGTTGTGTAAGCCTTGGAAGG - Intergenic
910403972 1:86866106-86866128 GGGATTGCTTGAGCCTTAGAGGG + Intronic
911125757 1:94339717-94339739 GTGGTATTTTCAGCCTTGCATGG + Intergenic
912437966 1:109675119-109675141 GTGGTTGTGTCTGCTTTAAAGGG + Exonic
912440477 1:109693578-109693600 GTGGTTGTGTCTGCTTTAAAGGG + Exonic
917681068 1:177368214-177368236 GAGGCTGTTCCAGCCTTAAATGG - Intergenic
1063690307 10:8280936-8280958 GAGGTTGTTTCACCCTGAGATGG + Intergenic
1064313540 10:14234237-14234259 GTGGTTGGTTCAGCCACTGATGG - Intronic
1065260505 10:23918923-23918945 GTGCTTGTTTAAGCCTTGTATGG - Intronic
1068683736 10:59847707-59847729 GTTGCTGTTTCAGAATTAGAAGG + Intronic
1073116129 10:101093034-101093056 GTGGCTTTCTCAGGCTTAGAGGG - Intronic
1076401464 10:130188304-130188326 GTGGTGGTTTCAGCATCAGGTGG - Intergenic
1079338146 11:19589433-19589455 GTGGTTGATTCTGCCTTGGAAGG + Intronic
1084510734 11:69601971-69601993 GTGGTGGTTTCAGCCCCACAGGG - Intergenic
1090851185 11:130572044-130572066 CTGGTTGTTTCTGCCTGAGAGGG + Intergenic
1093055681 12:14553666-14553688 CTGAGTGTTTCATCCTTAGAGGG + Intronic
1094717859 12:33031226-33031248 GTGGTTATTTCAGCCTCATGGGG - Intergenic
1096238117 12:49943441-49943463 GTGTCTGTTTCAGCCCTATAGGG - Intergenic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098407215 12:70139317-70139339 GTGGATGTTTGTACCTTAGAAGG + Intergenic
1100046650 12:90390168-90390190 GTGGTTATTTGAGACTGAGAAGG + Intergenic
1100360199 12:93870658-93870680 GTGGAGGTTTCAGGCTGAGATGG + Intronic
1100717296 12:97319292-97319314 GTGGTTTTTCCAGCCTTGGCTGG - Intergenic
1102192513 12:110999259-110999281 GGGGTCTTTTGAGCCTTAGAGGG - Intergenic
1102423282 12:112820991-112821013 CTTGTCGTTTCAGCCTTAGTCGG + Intronic
1102848263 12:116211453-116211475 GTGGCTGATTCTGCCTCAGAGGG + Intronic
1104235393 12:126930665-126930687 GTTGTTGATTCAGGCTAAGAGGG - Intergenic
1105662945 13:22519503-22519525 GTGGTTATCTTAGCCTTTGATGG - Intergenic
1109379961 13:61546333-61546355 GTGGTTGTTATAACCTGAGAAGG + Intergenic
1110249775 13:73368603-73368625 TAGGTTCTTTCAGTCTTAGAGGG + Intergenic
1112862036 13:103842628-103842650 GTGGTTGTTTCAGCAGTGGATGG + Intergenic
1113557285 13:111248186-111248208 TTTGTTGTTTCAGCATTTGAAGG + Intronic
1118528561 14:66674468-66674490 GTGGTTGCTAGAGGCTTAGAAGG - Intronic
1121031008 14:90658812-90658834 GTTGTGGTTTCTGCCTTTGATGG - Intronic
1127343527 15:58070003-58070025 GGGGCTGTTTCAGCCTCAGGTGG + Intronic
1128818005 15:70628642-70628664 GTGGCTCTTTCAGCCTTGGTTGG - Intergenic
1129204480 15:74027948-74027970 GTCCGTGTTTCTGCCTTAGAAGG + Intronic
1130895314 15:88165951-88165973 GTGATTTTTTCATTCTTAGAAGG - Intronic
1135030522 16:19034654-19034676 GTGGGGGTTATAGCCTTAGATGG + Intronic
1139619688 16:68127766-68127788 GTTATTGTTTCAGATTTAGATGG + Intronic
1142549392 17:728762-728784 CTGGTTTCTTCAGCCTTAAATGG - Intergenic
1143595188 17:7909746-7909768 GTGGTAGTTTCTGCCTTATGGGG - Intronic
1144745106 17:17608921-17608943 GTGTGTGTTTCGGCATTAGAGGG + Intergenic
1155681853 18:28496890-28496912 CTTGCTGTTTCAGCCTTACAGGG + Intergenic
1155942588 18:31814753-31814775 ATGTTTGTGTCAGCCTTGGAAGG + Intergenic
1156005837 18:32439784-32439806 GTGGCTGATTGAGACTTAGAGGG - Intronic
1156032872 18:32733226-32733248 GTGGTTGTCTCAGCCTTAATTGG - Intronic
1159831035 18:73278671-73278693 GTGCTTGTTTCAGCATTCCAGGG + Intergenic
1160565172 18:79782625-79782647 GTCGGCGTTTCAGCCTGAGAGGG - Intergenic
1162121274 19:8470655-8470677 GTTGTAGTTTAAGCCTCAGATGG + Intronic
927486599 2:23492269-23492291 ATGGTTGATTCAGCCTTGGGAGG - Intronic
928740200 2:34342608-34342630 ATGGGTGTTAGAGCCTTAGAAGG - Intergenic
929671586 2:43880130-43880152 TTGGTTGTTTCAGCCCTCAAAGG - Intergenic
931090160 2:58877071-58877093 GAGGTTGGTTCATCCTTAAAAGG - Intergenic
933342880 2:81045183-81045205 TTGGATGTTTCAGCTTTAAAGGG + Intergenic
934150528 2:89143829-89143851 GTGGTTGTTTCATCCTACTAAGG - Intergenic
934216755 2:90038199-90038221 GTGGTTGTTTCATCCTACTAAGG + Intergenic
936911530 2:117598608-117598630 GTGGTTGTGTCATCTTTTGAGGG - Intergenic
941470477 2:165879561-165879583 GTTGTTAATTCAGCCTAAGATGG - Intronic
942183796 2:173405307-173405329 CTGTTTGTTTCAGAATTAGAGGG + Intergenic
944738535 2:202589824-202589846 GTGGTTGCTACAGCCTGAGGAGG + Intergenic
945126017 2:206510812-206510834 CTCGCTTTTTCAGCCTTAGATGG + Intronic
946906738 2:224424614-224424636 GTGGTTATTTGAGACTGAGAAGG + Intergenic
948062386 2:235051448-235051470 GTGGTTGTTCCAGCCTCAGCTGG + Intronic
1168920989 20:1536165-1536187 CTGGTTGTTACAGCCTTTTAGGG - Intronic
1172487865 20:35309721-35309743 GGGATTGTTTCAGCTTTGGAGGG + Intronic
1177424300 21:20902476-20902498 GTGATTGCTTCACCCTTTGAAGG + Intergenic
1178040696 21:28637967-28637989 GTGGTTATTTGATCTTTAGAAGG + Intergenic
1179198695 21:39192661-39192683 CTGGTTATTTCAGCTTTAAAAGG + Intronic
1181614050 22:24039748-24039770 AAGGTTGTTTCAGCCTTAAAAGG + Intronic
1182722927 22:32418501-32418523 TTGGTTGTCACAGCCTGAGATGG - Intronic
1183799255 22:40147847-40147869 GTGGTTGTCTGGGCCTCAGAAGG + Intronic
955160287 3:56458756-56458778 GGGAATGTTACAGCCTTAGAAGG + Intronic
957924026 3:86785557-86785579 GTGTTTGTTTCACCAATAGATGG + Intergenic
970504284 4:16711272-16711294 ATGGTTTGTTCAGCCTTAGGTGG + Intronic
970947944 4:21716965-21716987 GTGGTAGTTTCACCTTTGGAAGG - Intronic
971309783 4:25515306-25515328 GTGGCTGATTCAACCTTAAAAGG - Intergenic
971330090 4:25674844-25674866 GTGGTTGTTTCAGCAAAAGTGGG + Intronic
987786984 5:22513203-22513225 GTGGTTGCTTTTGCCTTTGAAGG - Intronic
989401950 5:41017228-41017250 TTGTTGGTTTCAGCCTGAGACGG + Intronic
993416550 5:87640135-87640157 GTTGCTGTTTCCGCCTTACATGG + Intergenic
993619017 5:90146432-90146454 CTGGATGTTTCAACCTTATATGG - Intergenic
995756002 5:115504819-115504841 CTGGTGGTTACAGCCTTAGTGGG - Intergenic
999145820 5:149392872-149392894 GTGGTTGTTTCAGCCTTAGAGGG - Intronic
999538984 5:152551063-152551085 CTGGTTGGTTCTGCCTTACATGG + Intergenic
999767065 5:154749321-154749343 GTGCTTGTTTCCGACTCAGAGGG + Intronic
1001045937 5:168371598-168371620 GTGGTTCTTCCAGACTTGGAGGG - Intronic
1002476259 5:179468158-179468180 GTGTTTGTTACAGACTCAGATGG - Intergenic
1006544653 6:34769876-34769898 GTTGTTGTTTCAGAATTTGAAGG + Intronic
1007120433 6:39376174-39376196 GATGTTATCTCAGCCTTAGAGGG + Intronic
1011027505 6:82885479-82885501 GGGGTTATTTCAGCATTAAATGG - Intergenic
1011233112 6:85186356-85186378 TTGGTTGTTTCTTCCTTAGTAGG + Intergenic
1012332264 6:98007538-98007560 CTGGTGGTTTCTGTCTTAGAAGG + Intergenic
1012986610 6:105882879-105882901 GTGGAAGTTGCAGGCTTAGAAGG - Intergenic
1020000650 7:4753840-4753862 GTGGTTGCTCCAGCCTGGGAGGG + Intronic
1020522931 7:9217410-9217432 GTGGGTGTTTAAGACTGAGATGG + Intergenic
1021655811 7:22872594-22872616 GTTGTTGTTTCATTCTTGGATGG - Intergenic
1023350619 7:39316991-39317013 GGGATTGTCTCAGCCTGAGAGGG + Intronic
1027601121 7:80242603-80242625 GTTTTTGTTTCAGCATTAAAAGG - Intergenic
1031400879 7:121325360-121325382 GTGGTTTTTGCAGGCTGAGAGGG - Intronic
1031765555 7:125772846-125772868 GTGGTAATTTCAGCCTCATAGGG - Intergenic
1032429646 7:131850216-131850238 GTAGTTGTGCCAGCCTGAGAAGG + Intergenic
1039232408 8:35463125-35463147 GTGTCTGTTGCAGCCTTGGATGG + Intronic
1041037857 8:53813647-53813669 GTGTTAGTTTCAGGCTTACAGGG - Intronic
1041997058 8:64075641-64075663 GTTGTTTTTTAAGCTTTAGATGG + Intergenic
1045502551 8:102754379-102754401 GGGGTGGTGTCAGCCTGAGAGGG - Intergenic
1049072087 8:140364010-140364032 GTGGTCCTTTCAGCCTTAAGTGG - Intronic
1051962292 9:22781468-22781490 CTTCTTGTTTCAGCCTTAGGAGG + Intergenic
1053092585 9:35292823-35292845 TTGGTTGGCTCAGCCTAAGAAGG - Intronic
1053586097 9:39460530-39460552 GTGGTTGTTTGGGGCTCAGAGGG + Intergenic
1054580212 9:66904699-66904721 GTGGTTGTTTGGGGCTCAGAGGG - Intronic
1055243647 9:74216242-74216264 GTGGTTTTTGCAGACTTATAAGG + Intergenic
1055362037 9:75502187-75502209 GTGCCTGTTTCTGCTTTAGAAGG - Intergenic
1059094743 9:111400204-111400226 GCAGTTGTTTCAGCACTAGAGGG - Intronic
1189231500 X:39455664-39455686 TTGGCTGTTGCAGCCTCAGAGGG - Intergenic
1189372087 X:40436628-40436650 GTGGGTGTTTCTGCATGAGAAGG + Intergenic
1190189893 X:48268434-48268456 CTGGTTCTCCCAGCCTTAGAAGG + Intronic
1191758556 X:64622539-64622561 GTGGTGGTTTCAGCTTCAGTAGG - Intergenic
1192332580 X:70188850-70188872 GGGGTTTTTTCATGCTTAGATGG - Intronic
1193829451 X:86271259-86271281 GCTGTTGTTTCAGCCTTATAGGG + Intronic
1194015911 X:88620887-88620909 GTGGTTGTTACAGGCTAGGAAGG + Intergenic
1194240332 X:91436740-91436762 CAGTTTGTTTCAGCCTTAGTTGG + Exonic
1202040979 Y:20683804-20683826 GTGTCTGTTTGAGCCTTAGGTGG - Intergenic