ID: 999146585

View in Genome Browser
Species Human (GRCh38)
Location 5:149399969-149399991
Sequence GCTACTGTGAAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999146585_999146589 1 Left 999146585 5:149399969-149399991 CCTTCCTGCTTCTTCACAGTAGC 0: 1
1: 0
2: 1
3: 20
4: 251
Right 999146589 5:149399993-149400015 ACTGGCAAGCACCCCTATATGGG 0: 1
1: 0
2: 0
3: 0
4: 65
999146585_999146588 0 Left 999146585 5:149399969-149399991 CCTTCCTGCTTCTTCACAGTAGC 0: 1
1: 0
2: 1
3: 20
4: 251
Right 999146588 5:149399992-149400014 TACTGGCAAGCACCCCTATATGG 0: 1
1: 0
2: 0
3: 4
4: 40
999146585_999146593 18 Left 999146585 5:149399969-149399991 CCTTCCTGCTTCTTCACAGTAGC 0: 1
1: 0
2: 1
3: 20
4: 251
Right 999146593 5:149400010-149400032 TATGGGTTTGTCCACATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999146585 Original CRISPR GCTACTGTGAAGAAGCAGGA AGG (reversed) Intronic
900077096 1:826955-826977 GCGATTGTGCAGAAGCACGAGGG + Intergenic
901136706 1:7001792-7001814 GATAATGTCAAGAAGAAGGAAGG - Intronic
901609981 1:10490334-10490356 GTTACTGGGCAGATGCAGGATGG + Intronic
902083724 1:13839901-13839923 GCTATTGTGAAAAAGCAGTGTGG - Intergenic
902565166 1:17306598-17306620 TCTACTGGGAAGTGGCAGGAGGG - Intergenic
902722310 1:18312048-18312070 GCTACGGAGAAGCAGAAGGAAGG - Intronic
903112675 1:21150126-21150148 GTTCCTGTGAAGAAGCAGGAGGG - Intronic
903955064 1:27019818-27019840 GCTACTGTGAAGACCAAGGTGGG - Intergenic
905272961 1:36798802-36798824 ACTCCTGTGTGGAAGCAGGAGGG - Exonic
905662894 1:39741303-39741325 GGTAGTGGGAAGAAACAGGATGG - Intronic
905786419 1:40761322-40761344 GCCACCCTGAAGCAGCAGGATGG - Intronic
906007054 1:42483095-42483117 GTTACTCTGAAGGAGGAGGAAGG - Intronic
906672148 1:47664205-47664227 GATGCTGAGAAGAAGCAGGGAGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908000555 1:59674181-59674203 GCTGCTGTCAAGAGGAAGGATGG - Intronic
909666701 1:78142277-78142299 TCTACTGTGAGAAAGCTGGAAGG + Intergenic
910554421 1:88515414-88515436 GGTACTGTGTAGATGCGGGAAGG - Intergenic
910667070 1:89737158-89737180 GGTGCTGTGCAGAGGCAGGATGG - Intronic
915212675 1:154322235-154322257 ATTAGTGTGAGGAAGCAGGATGG - Intronic
916981569 1:170143729-170143751 GCTACTCTGGAGAATCAGGTGGG + Intergenic
917630021 1:176882401-176882423 GCAAAGGTGAAGAAGCATGAAGG - Intronic
917734125 1:177904974-177904996 GATAATGTCAAGAAGCAGAAAGG + Intergenic
918857598 1:189779041-189779063 GCTATTTTGTAGAAGCAGAATGG - Intergenic
920440766 1:205979110-205979132 GCTCCTGGGAAGAGGCTGGAGGG - Intronic
922125249 1:222714699-222714721 GCTACTGGGAAGACTGAGGAGGG - Intronic
922549724 1:226485141-226485163 TGTGCTGTGAAGATGCAGGAGGG + Intergenic
922608974 1:226910392-226910414 GCCACTGTAAAGAAACAGCATGG - Intronic
923935164 1:238751760-238751782 ACAACTGTGAAAAAGCAGTATGG - Intergenic
924038778 1:239963194-239963216 TTTACTGTGAAGACTCAGGATGG + Intergenic
924375852 1:243407901-243407923 ACTACTGAGAAGAAACAGAAAGG - Intronic
924545069 1:245018996-245019018 GCTACTGTCAGGAAGCCTGAAGG - Intronic
1063352814 10:5372335-5372357 GCTACTGTGAAGGAGCCCGGCGG + Intronic
1063828911 10:9930461-9930483 GCGAGTGTGGAGAAGCAGGCGGG + Intergenic
1065837771 10:29674844-29674866 GCTGCCTTGAAGATGCAGGAAGG - Intronic
1067143523 10:43676527-43676549 GCTAATTTGAGGAAGTAGGATGG + Intergenic
1067375740 10:45726826-45726848 GCTGCTGTGAAGGAGCTGGTAGG - Intergenic
1067726597 10:48775303-48775325 GCTCCTGTGTATAAGCAGCAGGG - Intronic
1067883450 10:50067514-50067536 GCTGCTGTGAAGGAGCTGGTAGG - Intergenic
1068098103 10:52517199-52517221 GCTATTGTGAGGAAGCAGACAGG + Intergenic
1069044970 10:63733687-63733709 GCTACTGTGAAAAATAAAGAAGG + Intergenic
1069603734 10:69726668-69726690 GCTACTGTGAGGATGAAGGAAGG - Intergenic
1073773502 10:106760993-106761015 GCTACTGGGAAGGATGAGGAAGG + Intronic
1074050580 10:109877737-109877759 GCTCCTGTGCAGAAGCAGCAAGG + Intronic
1074831100 10:117250031-117250053 GATACTGTGGGGAAGCAGAAAGG + Intronic
1075278224 10:121114588-121114610 GATACTCTCAAGAAGCAGGGAGG - Intergenic
1075628737 10:123986237-123986259 ACAACTGTGAGGAAGCAGGTCGG + Intergenic
1075683350 10:124347824-124347846 GCGTCTGTGCAGAAGCAGCACGG - Intergenic
1076148523 10:128144550-128144572 GCCACTGTGCAAAAGCAGAAGGG + Intergenic
1076761570 10:132608498-132608520 GCCACTGTGAAGAGACAGGCTGG + Intronic
1079507655 11:21172073-21172095 GCTACTGTGAAAATCCAAGAAGG + Intronic
1083628273 11:64082934-64082956 GCTGCTGTGACGAGGAAGGAAGG - Intronic
1084065245 11:66700449-66700471 GGAAATGTGAAGGAGCAGGATGG - Intronic
1084422456 11:69067139-69067161 GCTACGGGGCAGAGGCAGGAGGG - Intronic
1084585833 11:70061724-70061746 GCAACTGTTAAGAAGCATCATGG - Intergenic
1084652220 11:70495918-70495940 GCACCTGTGGAGATGCAGGAAGG + Intronic
1084759885 11:71263659-71263681 GCTGCAGAGAAGCAGCAGGAGGG + Intergenic
1085634768 11:78150162-78150184 GCTACTGGGAAGAATGAGGCAGG - Intergenic
1090278161 11:125433899-125433921 GCATCTGTTTAGAAGCAGGAAGG + Intergenic
1091321239 11:134653645-134653667 GTTACTGTTAATAAGCAGGGTGG + Intergenic
1092244436 12:6855736-6855758 CTTTCTGTAAAGAAGCAGGAAGG - Exonic
1093210372 12:16300887-16300909 GCAACTGTGAAGAGGTAGAATGG - Intergenic
1094150053 12:27272787-27272809 TCTACTGTCAAGTAGCAGGCAGG - Intronic
1095331067 12:40965127-40965149 GTTACTGTGAAAAAGTGGGAAGG - Intronic
1096266542 12:50127492-50127514 GCTACTCTGGAGAATCAGGTGGG - Intergenic
1096578553 12:52569854-52569876 GGGAATGTGAAGAAGCAGGTGGG - Exonic
1096581858 12:52590831-52590853 GGGAATGTGAAGAAGCAGGTGGG - Exonic
1096918558 12:55059598-55059620 GTTACTGAGAACAATCAGGAAGG - Intergenic
1100248021 12:92783747-92783769 GCTACTGCGAAGAATCAGCAGGG + Intronic
1100384740 12:94095335-94095357 GCTACTGGGGAGAAGAATGAGGG + Intergenic
1100819155 12:98414999-98415021 ACCACTCTGCAGAAGCAGGAGGG + Intergenic
1102470179 12:113155307-113155329 GCTCCTGGGACGCAGCAGGATGG + Exonic
1104071743 12:125351866-125351888 GCTGCTGTCATGAAGCAGCAAGG + Intronic
1105793799 13:23831033-23831055 GCTACTGTGAAGCAGGGGAAAGG + Intronic
1108642481 13:52395666-52395688 GAGACTGTGAAGAAGCAAGCAGG + Intronic
1109456923 13:62605219-62605241 CCTACTGTGCTGAAGCAGGAAGG + Intergenic
1109929900 13:69202027-69202049 GGTGATGTGAGGAAGCAGGAAGG - Intergenic
1110347089 13:74461165-74461187 GATACTGTGAAGAAAGAGAAAGG - Intergenic
1110347090 13:74461187-74461209 GATACTGTGAAGAAAAAGAAAGG - Intergenic
1110347091 13:74461237-74461259 GATACTGTGAAGAAAGAGAAAGG - Intergenic
1113347823 13:109497852-109497874 GCTACTGTGAAAAACAAGAATGG - Intergenic
1113742507 13:112721330-112721352 GTTACGGGAAAGAAGCAGGAAGG + Intronic
1113948675 13:114059245-114059267 TGTGCTGTGAAGATGCAGGAGGG - Intronic
1114982719 14:28186343-28186365 GCTGCTCAGAAGAAACAGGAGGG + Intergenic
1115946215 14:38664188-38664210 GCTACAGTGAAATAGAAGGAAGG + Intergenic
1118691234 14:68342368-68342390 GGAACAGTGAAGAAGCAGAAAGG - Intronic
1120116482 14:80624078-80624100 GGTACTGTGAAGATTGAGGAAGG - Intronic
1121843593 14:97154716-97154738 GCACCTGTGATGCAGCAGGATGG + Intergenic
1122786635 14:104167094-104167116 GCGTCTGAGAAGACGCAGGAGGG + Intronic
1126865676 15:52934248-52934270 GCTACTGTGTCCAAGGAGGATGG + Intergenic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1131365876 15:91839064-91839086 GCTATTGTGAGGACGAAGGAGGG - Intergenic
1132834405 16:1945595-1945617 GCGACTGTGATGCACCAGGAGGG + Exonic
1133701342 16:8311988-8312010 GGTGATGTGAAGATGCAGGAGGG + Intergenic
1134195638 16:12157032-12157054 GCTACAGTGAGGGAGCCGGAGGG + Intronic
1134206118 16:12239148-12239170 GCTTCTGTGATGAAGGAAGAAGG + Intronic
1134381974 16:13736042-13736064 GCTTCTTTTAATAAGCAGGAAGG + Intergenic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1138157801 16:54722125-54722147 GCATTTGTGAAGGAGCAGGAGGG - Intergenic
1138930844 16:61653989-61654011 GCTACGATGATGAAGGAGGAGGG - Exonic
1139277360 16:65740408-65740430 GAAACTGGGAAGAAGCAGGAAGG - Intergenic
1140230500 16:73113589-73113611 GCTACTGGGAAGAGGCAAGGAGG + Intergenic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1141672666 16:85500859-85500881 GAGACTGTGAGGAAGCTGGAAGG - Intergenic
1142376304 16:89708732-89708754 GCTGCACTGTAGAAGCAGGAGGG - Intronic
1143135414 17:4710069-4710091 GCTGCAGTGAAGAAGCGGGAGGG + Intergenic
1143246364 17:5488986-5489008 GTTATTCTGAAGAAGCTGGATGG + Exonic
1144555252 17:16276338-16276360 GCTACTTAGAAGAAACAAGAGGG - Intronic
1148989501 17:51653176-51653198 GCAATTGTGAGGAAGCTGGAAGG + Intronic
1150542606 17:66118903-66118925 GCTATTGTGAATAAGCACTAGGG - Intronic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153783846 18:8516939-8516961 CCTCCTGTCAAGAAACAGGAAGG + Intergenic
1158085710 18:53649585-53649607 TCTACTTTGAAAAAGCAGGTAGG + Intergenic
1158975650 18:62709020-62709042 TATACCGTGAAGAAGCAGCATGG - Intergenic
1163323796 19:16590143-16590165 GCTACTGGAAAGAGGCAGGCAGG + Intronic
1163798127 19:19348841-19348863 TCTCCTGTGAAGATGCAGAATGG + Intronic
1164530239 19:29042917-29042939 CACACTGTGAAGGAGCAGGATGG - Intergenic
1164881933 19:31740154-31740176 GCTACTGTGGACAGGCAGGCAGG - Intergenic
1164960067 19:32420303-32420325 GCTGCTGTGAAGAATCTGGATGG + Intronic
1167779268 19:51586889-51586911 GTTTCTGTGAAGAAGCAAGGTGG - Exonic
925250431 2:2431623-2431645 GCTACTGTAATTAAGCAGTATGG + Intergenic
927267988 2:21174456-21174478 GCTACTGAGAAGACTAAGGAGGG - Intergenic
927701570 2:25272406-25272428 GCTCCCTTGAAGAAGCAGTATGG - Intronic
928000660 2:27520466-27520488 GGGATTGTGAAGAAGTAGGAAGG + Intronic
928711525 2:34011867-34011889 ACCACTGTGAATAAGCAGGATGG - Intergenic
930044043 2:47153401-47153423 ACTACTGTGAGGAAGCACGAGGG - Intronic
930743365 2:54856616-54856638 GATGCAGTGCAGAAGCAGGAAGG + Intronic
932514638 2:72333475-72333497 GTTTCTGAGAAGAAACAGGAGGG + Intronic
933614092 2:84465737-84465759 GCTACTCAGAAGAAACAAGAGGG - Intergenic
934159197 2:89232067-89232089 GAGACTGTGAGGAAGGAGGAGGG + Intergenic
934208076 2:89950358-89950380 GAGACTGTGAGGAAGGAGGAAGG - Intergenic
934790236 2:97053654-97053676 GTGACTGTGAGGAAGGAGGAAGG - Intergenic
934816232 2:97328883-97328905 GTGACTGTGAGGAAGGAGGAAGG + Intergenic
934821464 2:97379601-97379623 GTGACTGTGAGGAAGGAGGAAGG - Intergenic
936785976 2:116094704-116094726 GCTACTGACAACAAGCAGCATGG - Intergenic
944314779 2:198272735-198272757 GATACTGAGAAGCAGCAGGCAGG - Intronic
945077677 2:206056552-206056574 GCTGCTGTGAAGGTGCAGGAGGG + Exonic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
945854838 2:215056932-215056954 GCTTGTGTGAAGTAACAGGAAGG - Intronic
945977598 2:216282801-216282823 GCTACTGTGGAAAGGCAGGCAGG - Intronic
946162462 2:217844045-217844067 GGTTCTGTTAACAAGCAGGAAGG - Intronic
948066727 2:235086784-235086806 GGCACTGTGAGGAAGCAGGAGGG + Intergenic
948078698 2:235187882-235187904 GCTGCAGGGAAGAACCAGGATGG - Intergenic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948704981 2:239784811-239784833 GATACTGAGAAGAAACTGGAAGG + Intronic
1170595169 20:17799887-17799909 GCTAGTGTGAAGGTGGAGGAAGG + Intergenic
1171343370 20:24447424-24447446 GCTTCTGTGGTGAAGCTGGAAGG + Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1171999862 20:31765555-31765577 GCTACTGGGAAGACGGAGGCAGG - Intronic
1178395457 21:32238797-32238819 GCTGCTGTCAAGAAGAGGGAGGG + Intergenic
1179772711 21:43634975-43634997 ACTACTGAGAAGAACCAGGAAGG + Intronic
1181895610 22:26104968-26104990 GCTATTCTGATGATGCAGGAGGG + Intergenic
1181987484 22:26810611-26810633 GGTCAGGTGAAGAAGCAGGAAGG - Intergenic
1182663025 22:31938438-31938460 GCTCCTCTGAACAAGCTGGAGGG + Intronic
1183823325 22:40364919-40364941 GCTTCTGTGGTTAAGCAGGAAGG + Exonic
949536859 3:5003016-5003038 ACTGCTGTGAAGAAGCAGAGCGG - Intergenic
949889728 3:8724983-8725005 GCTACTGTGAATAAGAAGAGCGG - Intronic
950035032 3:9879020-9879042 GCCACTGTGAAGCCTCAGGAAGG - Intronic
952109430 3:30105461-30105483 GCTACTTGGAAGAAGGAGGCAGG + Intergenic
953137359 3:40192882-40192904 GTTACTATGTAGAAGCATGATGG - Intronic
954426679 3:50447104-50447126 GCAAAGGTGAAGAAGAAGGAAGG + Intronic
956827601 3:73013042-73013064 TCTACTATGAACAAGCAGGCAGG - Intronic
959117367 3:102194189-102194211 ACTACGGTGAAGAGGCAAGAGGG + Intronic
959202538 3:103266878-103266900 GCTTCACTAAAGAAGCAGGAAGG + Intergenic
959211526 3:103389616-103389638 GCCACTGTGAAGAAGAAGAGTGG + Intergenic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962674369 3:137743543-137743565 GATTCTGTTAAGAAGAAGGAAGG + Intergenic
963634596 3:147778203-147778225 GCTTCTGTGGAGAAACAGGTTGG - Intergenic
963791360 3:149586115-149586137 GCTACTTTCATGAAGAAGGATGG - Intronic
965734138 3:171803100-171803122 ACTACTGTGATGGAGAAGGAGGG + Intronic
966721543 3:183067645-183067667 GCTGCTCAGAAGAAACAGGAGGG + Intronic
967920170 3:194608638-194608660 GCAGCTGTGAAAAATCAGGAGGG + Intronic
967984063 3:195082414-195082436 GCAGCTGTGCAGGAGCAGGAAGG + Intronic
968469507 4:772884-772906 CCTGCTGTGAAGACGCATGAAGG + Intergenic
968667825 4:1830834-1830856 TCTAGAGTCAAGAAGCAGGAAGG - Intronic
969418148 4:7074470-7074492 CCTACTGAGAAGGAGCAGGAGGG - Intergenic
969870693 4:10102730-10102752 GCTGCTGTGCACACGCAGGATGG + Intronic
969961869 4:10952629-10952651 GCCACTATGCAGAAGCAGGTTGG + Intergenic
971153204 4:24055811-24055833 GCTACTGTAGGGAAGTAGGAGGG - Intergenic
971917013 4:32884333-32884355 CCAACTGTCAAGAAGCATGAAGG - Intergenic
972897980 4:43646167-43646189 GCTACTCTGGAGAATAAGGAGGG + Intergenic
977005865 4:91569208-91569230 GCAACTGTGAGGAAGCACAAGGG - Intronic
978837922 4:113175786-113175808 GTGACTCTGAAGAAGAAGGAGGG - Intronic
981223547 4:142265013-142265035 TCTTCTGTGTATAAGCAGGAAGG - Intronic
983543876 4:168941695-168941717 GCGACTGTGGAGAAATAGGAAGG - Intronic
985966805 5:3343846-3343868 GAGACTGGGAAGAAGCAGGGTGG + Intergenic
986186311 5:5444305-5444327 GCTAAGGTGAAGAAGCTGCAAGG + Exonic
986604570 5:9508746-9508768 ACTACAGTGAAGTGGCAGGAGGG - Intronic
987971365 5:24949224-24949246 GTTATTGGGAAGAATCAGGATGG - Intergenic
989285742 5:39697630-39697652 GATAGTGTTAAGAAGCTGGAAGG - Intergenic
989742176 5:44786132-44786154 GCTACTGAGAAGAAATAAGAGGG - Intergenic
990724790 5:58741438-58741460 GCTAATGTGATGACTCAGGATGG - Intronic
992474209 5:77086935-77086957 GCGACTGTGAGAAAGCAGGTGGG - Intronic
992493658 5:77270767-77270789 CCTTCTGGGAAGAAGCAGCAGGG + Intronic
993062062 5:83050440-83050462 GTTACTGTGAGGCAGCAGGTGGG + Intergenic
999036035 5:148350826-148350848 ACTACTATGCAGAAGCAGTATGG - Intergenic
999125000 5:149240086-149240108 GGCACTGAGAAGCAGCAGGAAGG + Intronic
999146585 5:149399969-149399991 GCTACTGTGAAGAAGCAGGAAGG - Intronic
999589248 5:153125731-153125753 GCTACCCTGAATAAACAGGATGG - Intergenic
1002608904 5:180400936-180400958 GCTACTGTTGAGCAGCAAGAAGG - Intergenic
1002701758 5:181129792-181129814 GCGAAGGTGAAGGAGCAGGAAGG - Intergenic
1002714392 5:181217436-181217458 GCTTCAGAGAAGAAGCCGGAGGG - Intergenic
1003599012 6:7501008-7501030 TCTACTGAGAAGAAACAGGTAGG + Intergenic
1005494770 6:26378741-26378763 GCTGCTTTGAAGATGGAGGAAGG - Intergenic
1005503998 6:26454159-26454181 GCTGCTTTGAAGATACAGGAAGG - Intergenic
1005950421 6:30627219-30627241 GTTATTGTGAGGAAGCAGAAAGG - Exonic
1005955909 6:30663286-30663308 GCTAAGGTAAAAAAGCAGGAAGG + Intronic
1011514005 6:88132266-88132288 GCTACTGTGCTGAAGCAGAAAGG - Intergenic
1011563938 6:88654589-88654611 GTTACTGGGAAGAGGGAGGAAGG - Intronic
1013080410 6:106807078-106807100 GCTACTGTTAAAAGGGAGGAAGG - Intergenic
1013152896 6:107463123-107463145 GCAACTGTGAAAAAGAACGAGGG + Intergenic
1013247620 6:108301838-108301860 GCTACTCAGAAGAAACAAGAGGG - Intronic
1015944476 6:138486096-138486118 TGTTCTCTGAAGAAGCAGGAAGG - Intronic
1016736516 6:147485684-147485706 GCTAGTCTGAAAAAGCAGGAGGG + Intergenic
1017875374 6:158519942-158519964 GCTACTGTGGAACAGGAGGAAGG - Intergenic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1018857212 6:167683374-167683396 GCTTCTGTCCAGAGGCAGGAGGG - Intergenic
1019908934 7:4086559-4086581 GCTGCTCTGAAGATGAAGGAAGG - Intronic
1022027736 7:26464629-26464651 GCTTGTGTGAAGGAGGAGGAGGG + Intergenic
1024054335 7:45649987-45650009 GATGCTGGGCAGAAGCAGGAAGG + Intronic
1024441698 7:49426998-49427020 GCGACTGTGAATAAAGAGGATGG + Intergenic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1025025331 7:55512064-55512086 GCTACTATCAAAAAGCATGAGGG + Intronic
1026993747 7:74602716-74602738 TCTGCTGTGATGAAGAAGGAGGG - Intergenic
1028654515 7:93188331-93188353 GCTTCTGTGAAAATGCAGGAAGG + Intergenic
1029188391 7:98755320-98755342 GCTTCTGTGGAGATGCAGAAGGG + Intergenic
1031286015 7:119869094-119869116 GCTACTATGAAAAAGTAGTATGG - Intergenic
1031395238 7:121265661-121265683 GCTGCTGGGAATGAGCAGGAGGG + Intronic
1031501568 7:122524495-122524517 GGTACTGTGAAGAAAAAGAATGG + Intronic
1032046216 7:128611024-128611046 GCTACTGTGACACAGCAAGATGG + Intergenic
1035062334 7:156078884-156078906 ACCATTGTGAAGAATCAGGAGGG - Intergenic
1035516075 8:232922-232944 GCGATTGTGCAGAAGCACGAGGG - Intronic
1037622162 8:20574056-20574078 GGTACTGTGAAGAAAAAGGAAGG - Intergenic
1039104335 8:33973932-33973954 GCTTCTTTGAAGAAGAAGGAAGG - Intergenic
1039688324 8:39833734-39833756 GCTACTGGGAACAAGAAGGAGGG + Intronic
1041389393 8:57335612-57335634 GGAGCTGTCAAGAAGCAGGAGGG + Intergenic
1044802879 8:95975173-95975195 TCTACAGTGAAGATGCAGGCAGG - Intergenic
1045322525 8:101092569-101092591 GCAGCTGTGAGGAAGGAGGATGG - Intergenic
1046161161 8:110366857-110366879 GCTGCTATGAAGAAGAAGAAAGG + Intergenic
1047009463 8:120655517-120655539 ACTAATGGGAAGAGGCAGGATGG - Intronic
1047298742 8:123594424-123594446 TCTACCAAGAAGAAGCAGGATGG - Intergenic
1047893972 8:129344628-129344650 GTAACTGTGAAGGAACAGGAGGG - Intergenic
1048120770 8:131579086-131579108 GTGACTGTTAAGAAGGAGGATGG + Intergenic
1048950333 8:139491567-139491589 GATTCAGGGAAGAAGCAGGATGG + Intergenic
1048972128 8:139651040-139651062 GCAGCTGGGAAGAAGCAGAAGGG - Intronic
1048972144 8:139651123-139651145 GCAGCTGGGAAGAAGCAGAAGGG - Intronic
1049342772 8:142122200-142122222 GAAACTGTGAAAACGCAGGATGG + Intergenic
1051068547 9:13134887-13134909 GAGACTATGAAGAACCAGGAGGG - Intronic
1051907911 9:22117693-22117715 GTCACTGTGGAGAAACAGGAAGG + Intergenic
1052242338 9:26289313-26289335 GCTACAGTAAACAAACAGGATGG - Intergenic
1052430987 9:28366187-28366209 GCATCTGTGAAGAAGAAGCAGGG + Intronic
1053596503 9:39567002-39567024 GCCCCTGTGGAGCAGCAGGAAGG - Intergenic
1053854468 9:42323642-42323664 GCCCCTGTGGAGCAGCAGGAAGG - Intergenic
1054569756 9:66798016-66798038 GCCCCTGTGGAGCAGCAGGAAGG + Intergenic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1057278596 9:93693331-93693353 GCTACTGTGATGAGGCAAGGAGG + Intergenic
1059467976 9:114481439-114481461 GTTAAGGTGAAGAGGCAGGATGG + Intronic
1059990176 9:119857976-119857998 GCTGCTTTGAAGATGAAGGAAGG - Intergenic
1060666010 9:125432687-125432709 GCTACTATGTGGAGGCAGGAAGG + Intergenic
1061384401 9:130279995-130280017 GCTGCTTTGAAGATGGAGGAAGG + Intergenic
1188680740 X:33001053-33001075 CCTACTGTTAAGACACAGGATGG + Intronic
1188990038 X:36807175-36807197 GCTGCTTTGGAGATGCAGGAAGG - Intergenic
1189275072 X:39779487-39779509 GCTTCTTAGAAGACGCAGGATGG + Intergenic
1189573153 X:42321166-42321188 AGTATGGTGAAGAAGCAGGAAGG + Intergenic
1191004900 X:55701002-55701024 GCTACTCAGAAGAAACAAGAGGG - Intergenic
1191055290 X:56233768-56233790 GCTTCTGAAAAGAAGGAGGAGGG + Intronic
1192809257 X:74535229-74535251 GCTACTGTGGAGAAGTGGCAGGG - Intergenic
1197583443 X:128313318-128313340 GCTGTTGTGAGGAAACAGGAGGG + Intergenic
1197776997 X:130124942-130124964 GCTACTCAGAAAAACCAGGATGG + Intergenic
1199290286 X:146097373-146097395 GGTACTCAGTAGAAGCAGGAGGG + Intergenic
1199948427 X:152685926-152685948 GCTATTTAGAAGAAGCAAGAGGG + Intergenic
1199961252 X:152782530-152782552 GCTATTTAGAAGAAGCAAGAGGG - Intergenic
1200054753 X:153454438-153454460 GAGACCGTGAAGAAGCAGCAAGG - Exonic
1201865795 Y:18652801-18652823 GGTACTTTGAAGGAGCTGGAAGG - Intergenic