ID: 999147506

View in Genome Browser
Species Human (GRCh38)
Location 5:149406055-149406077
Sequence AACACTAAAGAATCTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999147503_999147506 -8 Left 999147503 5:149406040-149406062 CCCTGAGGCATGAAAAACACTAA No data
Right 999147506 5:149406055-149406077 AACACTAAAGAATCTGTAGGAGG No data
999147504_999147506 -9 Left 999147504 5:149406041-149406063 CCTGAGGCATGAAAAACACTAAA No data
Right 999147506 5:149406055-149406077 AACACTAAAGAATCTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999147506 Original CRISPR AACACTAAAGAATCTGTAGG AGG Intergenic
No off target data available for this crispr