ID: 999147961

View in Genome Browser
Species Human (GRCh38)
Location 5:149408133-149408155
Sequence CAGGGGACTTAGAGGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999147961 Original CRISPR CAGGGGACTTAGAGGAATGC AGG Intergenic
900208948 1:1444163-1444185 CAGTGCACTTTGAGGAGTGCTGG + Intergenic
901439087 1:9266702-9266724 CGGTGGATTTAGAGGAATCCTGG + Exonic
901784162 1:11613566-11613588 CAGTGGACTTTGAGGAAAGCAGG - Intergenic
901954576 1:12775052-12775074 CAGGGACCCTAGAGGAAGGCAGG - Exonic
903196146 1:21689785-21689807 CAGGAGACTTAGAGGAGGTCAGG - Intronic
903827231 1:26155147-26155169 GAGGGGACTTAGAGAAAAGATGG - Intergenic
905812310 1:40921667-40921689 CAGGGGGCATAGAGAAGTGCAGG - Intergenic
906997028 1:50807366-50807388 CAGGAAACTTACAGTAATGCCGG + Intronic
910859904 1:91733131-91733153 AAGGGGACTTAGAGGAGGGCTGG - Intronic
912315208 1:108661631-108661653 CGGGGGCCTTAAAGGAATGTAGG + Intergenic
912684828 1:111754230-111754252 GAGGGCACTAAGAGGAAGGCTGG + Intronic
913614035 1:120538423-120538445 CAGGGGACTTAGGAAGATGCAGG + Intergenic
914576233 1:148972470-148972492 CAGGGGACTTAGGAAGATGCAGG - Intronic
917608556 1:176662134-176662156 CTTGGGAATTAGAGGAATTCAGG + Intronic
919770015 1:201152118-201152140 GCAGGTACTTAGAGGAATGCGGG + Intronic
919809305 1:201399032-201399054 CAGGGTGCTTAGGGGAAGGCTGG - Intronic
920245242 1:204582908-204582930 CAGGGGAAGTAGATGACTGCTGG + Intergenic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924383224 1:243482344-243482366 CAGGGGACTCATAAGAGTGCTGG - Intronic
1062947492 10:1472528-1472550 CTGGGGACTTGGAGGTATGCTGG + Intronic
1067914783 10:50385665-50385687 AAGGTGACTTAGGGGCATGCTGG + Intronic
1069918090 10:71799357-71799379 CAGGGGGCTTAGAGGCTGGCAGG - Intronic
1070830863 10:79417373-79417395 CAGGGAACTTGGAGGAAGCCAGG + Intronic
1073380795 10:103076608-103076630 CAGGAGACTTGGAGGGTTGCGGG + Intronic
1078781886 11:14446831-14446853 AAGGGGATTTCCAGGAATGCTGG - Intronic
1082777604 11:57259444-57259466 CAGGGCACTGGGATGAATGCAGG + Intergenic
1085339130 11:75719940-75719962 CAGGGGTCTGAGAGGAAGGCAGG - Intronic
1085526085 11:77165151-77165173 CAGGGGACACACAGGAATGGAGG - Intronic
1086492462 11:87369351-87369373 AAGAGGACTTAGAGGCAGGCAGG - Intergenic
1088995597 11:114993590-114993612 CGGGAGATTTAGAGGAATGATGG - Intergenic
1089061745 11:115631493-115631515 CAGGAGACTTAGAGTAAAGAAGG + Intergenic
1089282732 11:117385741-117385763 CAGGGGACTGAGAGGAAGCCAGG + Intronic
1091347860 11:134867242-134867264 GAGGGGACTGAGAGGAAGGCTGG + Intergenic
1091740316 12:2956596-2956618 CAGGGGACGGAGAGGAAAGCAGG - Intergenic
1091793014 12:3282226-3282248 CCGGGGACCCAGAGGAGTGCAGG - Intronic
1092802267 12:12181069-12181091 CAGAGGACTTAGAGGAACCCCGG - Exonic
1095097531 12:38156371-38156393 AAGGGGACGTAGAGGAAGTCCGG + Intergenic
1095685376 12:45027347-45027369 CAAAGGACTTAGAGCAAAGCTGG + Intronic
1098006743 12:66005303-66005325 CAGTGGACTTTGAGAAAAGCAGG + Intergenic
1098307624 12:69117440-69117462 CAGAGGGCTCAGAGGAAGGCAGG - Intergenic
1101415562 12:104505213-104505235 CAGGGGACGTTTAGCAATGCTGG + Intronic
1101428346 12:104606131-104606153 CAAGGGATTTAGAGGAATTCTGG + Intronic
1102434878 12:112914100-112914122 CATGGGACTTTGCGGACTGCGGG - Intronic
1107703574 13:43075654-43075676 CGAGGGACTTAGAGGAATAGGGG - Intronic
1108205938 13:48090399-48090421 TAGGGAACTTATAGAAATGCTGG - Exonic
1108268372 13:48734369-48734391 CAGGGTACTGATAGGAATGGTGG + Intergenic
1109924916 13:69124147-69124169 CTGGGGACTTGGGGGAATGGTGG + Intergenic
1112688606 13:101862672-101862694 CATGGGAATTACACGAATGCTGG + Intronic
1114672258 14:24417513-24417535 CAGTGGACTGAGAGCACTGCTGG - Exonic
1118229691 14:63936581-63936603 CTGGGGAGTTTGAGGAATACAGG + Intronic
1120759026 14:88269907-88269929 CAGGTGACATGGAGGAATGGAGG - Intronic
1121928679 14:97952258-97952280 CATGGGACTGAGAGGATTCCAGG + Intronic
1122022604 14:98851610-98851632 CAGGGGGCAAAGAGGAAGGCTGG + Intergenic
1124142190 15:27087286-27087308 CAGGGGCCTGAGTGGAATCCCGG + Intronic
1126123309 15:45272669-45272691 CTGGGGACATAGAGGATTCCTGG - Exonic
1126780730 15:52137091-52137113 AAGGGTACTTAGAGGATTTCAGG - Intronic
1127526869 15:59801783-59801805 CAAGAGCCTTTGAGGAATGCAGG + Intergenic
1128702575 15:69814940-69814962 CAAGGGACCAAGAGGGATGCAGG + Intergenic
1129300186 15:74620971-74620993 CAGGGGACTGAGCGCAATGTGGG - Intronic
1130059306 15:80558199-80558221 CAAGGGACTTAGAAGGAGGCTGG - Intronic
1131331840 15:91507600-91507622 CAGAGGTCTTAGAGGAATCATGG + Intergenic
1131637136 15:94247960-94247982 CAGGGCACTTACAGTATTGCAGG + Intronic
1133430692 16:5734492-5734514 CATGGGGCTTAGAGGAAATCAGG - Intergenic
1133735290 16:8610397-8610419 CAGGGGACTCCCAGGATTGCAGG + Intergenic
1134071006 16:11259743-11259765 CAGGGGACTCAGAGGTCTTCAGG + Intronic
1134826846 16:17291574-17291596 CAGGGGCCTCAGAGGATTTCTGG - Intronic
1137674920 16:50299464-50299486 CAGGGGACCTAGAGGGGAGCGGG - Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1140772964 16:78222962-78222984 GAGGGGAGCCAGAGGAATGCAGG + Intronic
1143030789 17:3965782-3965804 CTGTGGAGCTAGAGGAATGCTGG + Intergenic
1145048855 17:19643424-19643446 TAGGGGCCTAAAAGGAATGCTGG + Intergenic
1146328510 17:31907448-31907470 CAGGGGACTTGGAACAAGGCAGG - Intergenic
1148797843 17:50205733-50205755 CAGGGGCCTGAAAGGAACGCAGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1152291917 17:79444584-79444606 CAGGGGACAGAGAGGAGTCCAGG - Intronic
1152930526 17:83107450-83107472 CAGGGGACTGTGAGGGCTGCGGG + Intergenic
1154158364 18:11960923-11960945 CAGGGGCCTTAGAGGAGTTAGGG + Intergenic
1155205861 18:23557316-23557338 AAGGGGACTTAGGGGAAAGAAGG - Intronic
1156198737 18:34806366-34806388 GAGGGGACATAGAGGAATGAGGG - Intronic
1157045655 18:44099463-44099485 CAGGGGAGGTAGAGGCTTGCAGG + Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1158280302 18:55818069-55818091 CAGGGAACTTAACTGAATGCTGG + Intergenic
1159960985 18:74555568-74555590 CAGGGGTCAAGGAGGAATGCTGG + Intronic
1160512236 18:79459075-79459097 CCGGGGTCTTTGAGGAAGGCAGG + Intronic
1161058216 19:2201064-2201086 GAGGGGACGACGAGGAATGCAGG - Intronic
1161206078 19:3042062-3042084 CAGGGGAGTGAGGGGATTGCGGG + Intronic
1161871105 19:6870713-6870735 CAGGGGACTTAGGGGAATGATGG - Intergenic
1164752293 19:30665857-30665879 CAGAGGACTGAGAGGAAAGGAGG + Intronic
1165815540 19:38639886-38639908 CAGGGCCCTCTGAGGAATGCTGG - Intergenic
1168262555 19:55204521-55204543 CAGGGGACCTTGTGAAATGCAGG + Intronic
925910148 2:8568645-8568667 CAGTGGACTTTGAGTAAAGCAGG + Intergenic
929598809 2:43192338-43192360 CAGGGGACTCTGAGGACTGGAGG - Intergenic
929618814 2:43334325-43334347 AAGGGCACTTACAGGAAAGCTGG + Intronic
932846027 2:75136630-75136652 AAGGGGACTTTGAGAGATGCTGG - Intronic
933243887 2:79953557-79953579 CAGTGGACTTAGAAAAGTGCTGG - Intronic
935109736 2:100081517-100081539 CAGGGGACGTTCAGGAATGCCGG - Intronic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
937795774 2:126018530-126018552 GTGGGGAAATAGAGGAATGCTGG - Intergenic
937958132 2:127434740-127434762 CAGTGGACTTTGAGTAAAGCAGG - Intergenic
940089737 2:149902006-149902028 CAGGGAACTACGAGGAAGGCTGG - Intergenic
940444640 2:153763785-153763807 CAGAGGGCTTAGAAGAAGGCAGG + Intergenic
942350398 2:175046542-175046564 CAGGGTAATTAGAGTAATGTTGG + Intergenic
945709588 2:213278813-213278835 TAGGGGACTGTTAGGAATGCAGG + Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
947014837 2:225607802-225607824 CAGGGGCCTTAGAGAACTGTGGG + Intronic
948099335 2:235360919-235360941 CAGTGGACTTTGAGTAAAGCAGG + Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172294956 20:33802970-33802992 CATGGGGCTTAGAGGGATGATGG + Intergenic
1173525771 20:43731466-43731488 GAGGGGAGTGAGAGGAAAGCAGG - Intergenic
1174422605 20:50409488-50409510 CAGGGGACATTCAGCAATGCTGG - Intergenic
1178416625 21:32410516-32410538 CAGGGGACTTGGAGGTAGGCAGG - Intergenic
1180052267 21:45336574-45336596 CAGGGGCCAGAGATGAATGCTGG - Intergenic
1181376646 22:22463993-22464015 CAGGTGTCTTAAAGGAACGCGGG + Intergenic
1182096755 22:27630848-27630870 CAGGTGGCTTAGAGGGATGAAGG - Intergenic
1183364120 22:37398273-37398295 CAGGGGCCTTTGAGGAATAAAGG - Intronic
1183656565 22:39189000-39189022 CAGGGAACTGGGAGTAATGCTGG - Intergenic
950191073 3:10976532-10976554 CTGGGGACTAAGAGGCATCCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951778168 3:26333581-26333603 CAAGGTACTCAGAGAAATGCTGG - Intergenic
953409773 3:42684160-42684182 CAAGTGACTCAGAGGAATGATGG + Intergenic
953627991 3:44586462-44586484 CTTGGAACTTAGAGGAAAGCTGG - Intronic
954360699 3:50121308-50121330 CACAGGACTAAGAGGAATGGTGG - Intergenic
955732093 3:61997792-61997814 CAGGGAAATTAGTGGAAGGCTGG + Intronic
958632302 3:96699952-96699974 CAGGGCACTCAGAGGAGAGCTGG + Intergenic
960382674 3:116983595-116983617 CTGGGGCCTGAGAGGCATGCAGG + Intronic
962357997 3:134711381-134711403 CAGGAAACATAGAGGAATCCAGG - Intronic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
966948497 3:184795245-184795267 CTAGGGAGTTAGAGGATTGCTGG + Intergenic
967000227 3:185327158-185327180 AAGGGGCCTCAGAGGACTGCAGG - Intronic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
970600233 4:17636426-17636448 TAGGGCACCTAGAGAAATGCTGG + Intronic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
976020026 4:80611333-80611355 CAGGGGACATGTGGGAATGCTGG + Intronic
978765426 4:112400441-112400463 CAGGAGAATTAGAGGAATTTTGG + Intronic
983644922 4:169979874-169979896 CAGGGAACTTTAAGGATTGCTGG - Intergenic
984252254 4:177348565-177348587 CTGGGGACTCAGAGGATTGCAGG - Intronic
984436713 4:179718866-179718888 CAGAGGACGTATGGGAATGCCGG - Intergenic
984650051 4:182261430-182261452 CAGGGGACACACAGGAATGTGGG + Intronic
985848936 5:2374417-2374439 CAGGGGATTTTGAGAAAAGCTGG + Intergenic
987119503 5:14753443-14753465 AAGGGAATTTACAGGAATGCGGG + Intronic
987218414 5:15763990-15764012 CTGAGAACTTAGAGGACTGCTGG + Intronic
988415531 5:30942445-30942467 CAGGGTACTTGGAAGAATGGTGG - Intergenic
990662699 5:58035213-58035235 CAGGGGGTTTAGAGGAATCAGGG + Intergenic
992078588 5:73214132-73214154 CGGGGGACTTAGAGCATGGCTGG - Intergenic
994787097 5:104179519-104179541 TAGGTGACTTAAAGGAATGTGGG - Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997326231 5:133024242-133024264 CAGAGGAGTTAAATGAATGCAGG - Intronic
999147961 5:149408133-149408155 CAGGGGACTTAGAGGAATGCAGG + Intergenic
1001699798 5:173698520-173698542 CAGGGGGCTGAGAGCAAAGCGGG - Intergenic
1005471005 6:26162640-26162662 CAGGTGGCTGAGATGAATGCGGG - Intronic
1005811822 6:29521660-29521682 CAGGGGAGATGGAGGAATTCAGG + Intergenic
1006634174 6:35450422-35450444 CTGGGGACATGGAGGAATGGGGG + Intergenic
1006761609 6:36466959-36466981 TAGGGGACTTTGGGAAATGCTGG + Intronic
1007284797 6:40739871-40739893 CACCGGACCTAGAGCAATGCTGG + Intergenic
1008969162 6:57346659-57346681 CAGGGAACTTGGAGGAAAGAGGG - Intronic
1009158140 6:60248477-60248499 CAGGGAACTTGGAGGAAAGAGGG - Intergenic
1011618848 6:89223213-89223235 CAGTGGACTTAGAGGACTCGGGG - Intronic
1013793455 6:113859579-113859601 CAGGGGCCTTAGGGGGAAGCGGG + Intronic
1016734030 6:147456500-147456522 TAGGGGGGTTAGAAGAATGCTGG - Intergenic
1018149752 6:160926615-160926637 GAGGGGACTTAGAGGAGAGAGGG + Intergenic
1018779480 6:167049372-167049394 CAGGGAGCTGAGAGGAATGGCGG - Exonic
1019993136 7:4706424-4706446 CAGGGAAGTTCCAGGAATGCAGG + Intronic
1024730704 7:52250997-52251019 CAGGGGACTTATATTGATGCAGG + Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1033259381 7:139829372-139829394 CTGGGGTCTCAGAGGAATGATGG + Exonic
1035934979 8:3826593-3826615 AACGGGACTGAGAGGAAAGCTGG - Intronic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1038246594 8:25862639-25862661 CAGGAAACTTAGACAAATGCAGG - Intronic
1039338402 8:36620221-36620243 CAGGGGACATCAAGGAATGATGG + Intergenic
1039431477 8:37528559-37528581 CAGGTGACTAAAAGGAAGGCAGG - Intergenic
1040312458 8:46243840-46243862 AAGGGGACGTAGAGGCAGGCAGG + Intergenic
1045506534 8:102782559-102782581 CTGGGGAGCTAAAGGAATGCTGG + Intergenic
1049690146 8:143954723-143954745 CAGGGGGCACGGAGGAATGCTGG + Intronic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1051767562 9:20541242-20541264 CAGAGGACTCAGAAGAATACAGG - Intronic
1055144499 9:72916499-72916521 CAGAGGATTTAGGGGAGTGCTGG + Intronic
1056526541 9:87447833-87447855 CAGGGAGGTTGGAGGAATGCAGG - Intergenic
1059385070 9:113958285-113958307 GGGAGGACTTAGAGGCATGCTGG - Intronic
1061425414 9:130495248-130495270 CAGCGGGCTGTGAGGAATGCAGG + Intronic
1062630268 9:137460175-137460197 CAGGGGCCTCACAGGACTGCAGG + Exonic
1186478192 X:9875352-9875374 CAGTTAACTTAGTGGAATGCCGG + Intronic
1187305248 X:18089451-18089473 CAGGGGACTTAGTGGATTCTGGG - Intergenic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1192361779 X:70445213-70445235 CAGGGCACTTACAGCAGTGCTGG - Exonic
1193202085 X:78703636-78703658 CAAGGGAAATAGAGGAATTCTGG - Intergenic
1195327844 X:103772468-103772490 CAGGGGAAGTATAGGAATCCTGG + Intergenic
1196070153 X:111511706-111511728 CTGGGGACTTAGACTAATTCAGG + Intergenic
1196670014 X:118355977-118355999 CAAGGAACTGATAGGAATGCAGG - Intronic
1199814285 X:151384156-151384178 AAGGGGACTTAGAGTGATGGGGG - Intergenic
1200914117 Y:8556371-8556393 TTGGGCAATTAGAGGAATGCAGG - Intergenic