ID: 999148550

View in Genome Browser
Species Human (GRCh38)
Location 5:149411896-149411918
Sequence CTGTGTGCCCAGAGGGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999148550_999148557 28 Left 999148550 5:149411896-149411918 CCATTATCCCTCTGGGCACACAG 0: 1
1: 0
2: 3
3: 21
4: 231
Right 999148557 5:149411947-149411969 AAAGTCACACAGCCTGTACGAGG 0: 1
1: 0
2: 31
3: 258
4: 1298
999148550_999148554 -10 Left 999148550 5:149411896-149411918 CCATTATCCCTCTGGGCACACAG 0: 1
1: 0
2: 3
3: 21
4: 231
Right 999148554 5:149411909-149411931 GGGCACACAGAGGCTCAGAGAGG 0: 1
1: 1
2: 44
3: 526
4: 2506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999148550 Original CRISPR CTGTGTGCCCAGAGGGATAA TGG (reversed) Intergenic
900952351 1:5865150-5865172 CTGTGTCCCCCGAAGGACAAGGG + Exonic
901165709 1:7220337-7220359 CTTTGGGCCCAGAGGAATAATGG + Intronic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
903098357 1:21002784-21002806 CATTCTGTCCAGAGGGATAAGGG + Exonic
903142503 1:21347395-21347417 CTGTGTGCCCAGACGCATCCAGG - Intergenic
906279729 1:44544889-44544911 CTCTGTACCCAGTGGGAGAATGG - Intronic
907421115 1:54348110-54348132 CTCTGTCCCCAGATGGATATGGG - Intronic
907428801 1:54398515-54398537 CTGTGTGCCCAGAGGTGTCCTGG - Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908656609 1:66395056-66395078 CAGAGAACCCAGAGGGATAAGGG + Intergenic
911562017 1:99417965-99417987 TTGTGTTCCCAGGGGGATTATGG - Intergenic
913355709 1:117919532-117919554 GTGGTTGCCCAGAGGGATTAAGG + Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
917709595 1:177670911-177670933 TGGTGGGCCCAGAGGGACAAAGG + Intergenic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
919030200 1:192232225-192232247 GTGTCTGGCCAAAGGGATAAGGG + Intergenic
919927961 1:202202265-202202287 ATGTGTGCCCTGAGGGAAAAAGG - Intronic
924198554 1:241637043-241637065 CTGTGTGGCCAGAGGTAGAAAGG + Intronic
1066977022 10:42378512-42378534 CGGTTTGCACAGAGAGATAAAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1069773960 10:70916193-70916215 ATGTGTGCCCAGCGTGATGAGGG - Intergenic
1070719821 10:78748631-78748653 ATGTGTTCCCACAAGGATAATGG + Intergenic
1070780625 10:79135642-79135664 CTGGGTGGCCAGAGAGCTAAGGG + Intronic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1075098447 10:119489343-119489365 CTGTGTGCACAGAGGCTTAAAGG - Intergenic
1075903914 10:126064484-126064506 CTGTGTGCCCCGGGAGATACGGG - Intronic
1075998753 10:126898492-126898514 CTATGTGACCAGAGAGATAGAGG - Intergenic
1076166297 10:128285243-128285265 CTGAGTACCCAGGAGGATAAGGG - Intergenic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076988510 11:256869-256891 CTGTGAGGCCAGAGGAAGAAGGG + Intergenic
1079007841 11:16804593-16804615 CTGTGTGACCAAAGGGATCGTGG - Intronic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1082120877 11:48378508-48378530 TTATGTTCCCAGAGGGATTATGG + Intergenic
1082252963 11:50002134-50002156 TTGTGTTCCCAGAGAGATTATGG - Intergenic
1084288359 11:68146280-68146302 CTGTGTGCCAAGAGAGGTCAGGG - Intergenic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084722478 11:70916163-70916185 CTGTGAATCCTGAGGGATAAAGG + Intronic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1088119496 11:106351429-106351451 CTGTGTCCTCAGAGGTAGAAAGG + Intergenic
1088961143 11:114666247-114666269 CTGTGAGCCCAGGAAGATAATGG - Intergenic
1089182923 11:116595323-116595345 GTGTCTGCCCAGAGGTATCAAGG + Intergenic
1089205488 11:116758269-116758291 CTGTATGCCCAGTGGGGAAAAGG - Exonic
1089637663 11:119826510-119826532 CTGGGTGCCCAGAGGCAACATGG + Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091194193 11:133717938-133717960 CTGTGTCCTCAGAGGTAGAAGGG + Intergenic
1096574182 12:52542454-52542476 CTGTGAGCCCTGGGGCATAAAGG + Intergenic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1104035239 12:125093004-125093026 TGGTGTCCCCAGAGGGAGAATGG + Intronic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1106122568 13:26872839-26872861 CTGTGCGCCCTGGGGGACAACGG - Intergenic
1109258822 13:60118893-60118915 CTGTGTGCTGTGACGGATAAGGG - Intronic
1110315759 13:74104237-74104259 CTGTTTCCACAGAGGAATAACGG - Intronic
1110504730 13:76272195-76272217 TTGTGTTCCCAGGGGGATTATGG - Intergenic
1110603088 13:77399099-77399121 CTTTATGCCCAGAGAGAAAAAGG - Intergenic
1111758106 13:92424492-92424514 CTGTGTACCCAAAAAGATAAAGG - Intronic
1112738073 13:102443407-102443429 TTGTGTACCCAGAAGGATTATGG - Intergenic
1112911217 13:104486301-104486323 CTGTGTGATCGGAGGTATAAAGG - Intergenic
1114336958 14:21699990-21700012 TTGTGTTCCCAGGGGGATTATGG - Intergenic
1115480241 14:33853423-33853445 CTGTGTGCCCACAGGGGCTACGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1117997327 14:61490026-61490048 CTGTGTGCCCAGGGGTAACATGG - Intronic
1118907446 14:70032968-70032990 GTGTGTGCACACAGGGAAAAAGG - Intergenic
1119944734 14:78681361-78681383 ATCTGTGCCTATAGGGATAAGGG - Intronic
1121627077 14:95393686-95393708 CTGGGGCTCCAGAGGGATAAGGG - Intergenic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1124896554 15:33782621-33782643 GTGGGTGGCCTGAGGGATAAAGG + Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1125436831 15:39654885-39654907 TTGTCTGCCCAGAGGCTTAAAGG + Intronic
1125753378 15:42045554-42045576 CTCTGTGCTCAGAAAGATAACGG + Intronic
1126184833 15:45821755-45821777 CTATATTCCCAGAGGGATTATGG + Intergenic
1126333059 15:47554842-47554864 CTGTGTTCTCAGGGGGATTATGG + Intronic
1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129245938 15:74278677-74278699 CTGGGTGAAGAGAGGGATAAAGG - Intronic
1131509848 15:93043958-93043980 CTGTGTGGCCACAGGGCTTAAGG + Intronic
1133097828 16:3458937-3458959 CTGTGTGCCCAAACGGAGACAGG + Intronic
1134528804 16:14965971-14965993 CTGTGTGCCCAGAAGGCAAATGG - Intergenic
1135186508 16:20320423-20320445 CTGTGGGCCCAGGGAGATCAAGG - Exonic
1137500939 16:49011187-49011209 CTGTGTGGCCACAGGGAGAAAGG + Intergenic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1139867560 16:70075006-70075028 CTGTGTGCCCAGAAGGCAAATGG + Intergenic
1141405983 16:83793551-83793573 TTGTGTTCCCAGAGGAAAAAAGG - Intronic
1142827820 17:2525266-2525288 CTGTGTCTCCTGAGGGATAGAGG + Intergenic
1142861356 17:2763918-2763940 GTGTGTGCCCGGTGGGATCAAGG + Intergenic
1149549334 17:57528247-57528269 ATGTGTGCTCTGTGGGATAAAGG + Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1151409747 17:73914394-73914416 CTTTGTGCCCAGTGGGCAAAAGG - Intergenic
1152885129 17:82845130-82845152 CTGTGTGCCCCTAGGGAAAGAGG - Intronic
1153336029 18:3925639-3925661 CTGTGTGCCCGGAAGTATGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156620707 18:38848168-38848190 CTGTCTGTCAAGAAGGATAATGG + Intergenic
1159564260 18:70031359-70031381 ATGTGTCCCCAGAAGGAGAAAGG - Intronic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1165810635 19:38609753-38609775 CTGTGTGCCCAGAGGGTTACAGG - Intronic
1165895627 19:39139361-39139383 CGGGGTACCCAGCGGGATAAAGG + Intronic
1165959013 19:39519059-39519081 CTCTGTGCCCAGAGGGGTGATGG + Exonic
925783189 2:7402868-7402890 CTGGGTGCCCTGAAGGAAAAGGG + Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
927127322 2:20023975-20023997 CTGTCTGGCCAGAGGAATAGTGG - Intergenic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
930265916 2:49198958-49198980 CTGTGAGCTGAGAGAGATAAGGG + Intergenic
931249143 2:60514990-60515012 CTGTCTCACCAGAGGGAGAACGG - Intronic
931259230 2:60602607-60602629 CTGTGTGCCCAAATGTAAAAGGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933769285 2:85733069-85733091 CTCTGAGCCCAGAGGGAGCAGGG - Intergenic
935401485 2:102665031-102665053 GTTTGTGCCCAGAGTGACAATGG + Intronic
935442727 2:103121307-103121329 CTTTGTGGCCAGGGAGATAATGG - Intergenic
936029521 2:109059859-109059881 CACTGTGCCCAGGAGGATAATGG + Intergenic
938173674 2:129104791-129104813 CTGTGTGCCATGAGGGTTCAGGG + Intergenic
938342905 2:130547301-130547323 CTGTGTGCCCAAAGGGAGTCAGG - Intronic
938346928 2:130573421-130573443 CTGTGTGCCCAAAGGGAGTCAGG + Intronic
941493912 2:166177328-166177350 GTGTGTGCCCAGAATGAAAAAGG - Intergenic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
942110629 2:172679067-172679089 ATGTGTGCCTTTAGGGATAATGG + Intergenic
942323098 2:174753184-174753206 CTGTGTGCCCAGAAGTGTACTGG - Intronic
945048955 2:205805699-205805721 CTGGGTGCCAATAGGGATGAGGG - Intergenic
946161607 2:217839191-217839213 CCGTGTGGCCAGAGGAAGAAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946715529 2:222551287-222551309 ATGTGAGGCCAGAGGGAAAACGG - Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948185157 2:236015173-236015195 CTGAGTGCCCACATGTATAAAGG - Intronic
1169709116 20:8541427-8541449 CCATGTGCCCAGAAGGAGAATGG - Intronic
1173322550 20:42001380-42001402 CTCTGTGTCGAGAGGGAGAATGG + Intergenic
1173556377 20:43969114-43969136 TTGTGTGCCCAGTTGTATAAAGG + Intronic
1175102565 20:56590014-56590036 CTGTGTGCCCACATGAGTAAGGG + Intergenic
1175144722 20:56886809-56886831 CTGTGTTCCCAGACGGTTAAGGG + Intergenic
1176070147 20:63222087-63222109 GTGTGGGCACAGAGGGATCAGGG - Intergenic
1178724115 21:35036054-35036076 CTGTCTTCCCTCAGGGATAATGG - Intronic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182367628 22:29789499-29789521 ATGTGGCCCCAGAGGGAGAAAGG - Intronic
1182443287 22:30376426-30376448 CTGTCTGCCCAGAGGCCTGAAGG - Exonic
1183098276 22:35567701-35567723 CTGTGTGCCAGGTGGGACAAGGG + Intergenic
1183100782 22:35582841-35582863 CTCTGTGCCCGGAGGCAGAATGG + Intergenic
1183717109 22:39539970-39539992 CTGGCTTCCCAGAGGGATCAAGG - Intergenic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
951761179 3:26148713-26148735 TTGTGTACCTAGAAGGATAATGG - Intergenic
952850449 3:37724126-37724148 CTGTGTGCCCAGAGGCTGAGTGG - Intronic
953541986 3:43828429-43828451 CTGGCTGCCCAGAGGGCCAAGGG + Intergenic
954334747 3:49909723-49909745 CTGTGGGCCAAAAGGGACAAAGG + Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
955875709 3:63488412-63488434 TGGTGTGGCCAAAGGGATAATGG + Intronic
958263502 3:91409464-91409486 CTGGGAGCTCAGAGGGATTAGGG + Intergenic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
965082600 3:164053946-164053968 CTGTGTGCCCAAAGGGGGCATGG - Intergenic
969122958 4:4923305-4923327 CTGTGTCCCCATAGGCAGAATGG + Intergenic
969322134 4:6418684-6418706 CTGTGCTCCCAAAGGGACAATGG + Intronic
969385195 4:6840335-6840357 CTTTGTGGCCAAAGGGATGATGG + Intronic
969555411 4:7905480-7905502 CTGTGCGCCCAGAGGGCTTTGGG - Intronic
971328152 4:25661241-25661263 CTTTATGCTCAGAGGCATAAAGG + Intronic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
977513779 4:97995021-97995043 TTATGTTCCCAGAGGGATTATGG + Intronic
978716653 4:111851929-111851951 ATGTGTGCCAAGAGAGACAAAGG + Intergenic
978843932 4:113249486-113249508 CTGTGTGGACAGAGGGTCAATGG - Intronic
979254468 4:118597131-118597153 AGGTGTGCCCAGAGGGACAGAGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG + Intergenic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980617223 4:135244849-135244871 CTGTGTTCTTAGAGGGACAAGGG - Intergenic
980676207 4:136085201-136085223 CTGTGTTCCCAGAGGGCTTATGG - Intergenic
980710256 4:136557205-136557227 CTGTATGCCCACAGGAAGAAGGG - Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985561914 5:592288-592310 TTATGTTCCCAGAGGGATTATGG + Intergenic
987924662 5:24325050-24325072 CTGTGTGCTCAGAGTCATACAGG - Intergenic
989214124 5:38885951-38885973 GAGTATGCCCTGAGGGATAAGGG + Intronic
989384730 5:40844078-40844100 CTTTGTGACCAGAGAGATATGGG + Intronic
992014455 5:72561338-72561360 CTATGTGCTCAGAGAGATAATGG - Intergenic
993917042 5:93756147-93756169 TTGTGTACCTAGAGGGATTATGG - Intronic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
996165872 5:120222363-120222385 TTGTGTCCACAGAGGGATTATGG + Intergenic
996495300 5:124148661-124148683 TTATGTTCCCAGAGGGATTATGG + Intergenic
998373770 5:141678349-141678371 GTGTGTGCCCAAAGGGATCCAGG - Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999650541 5:153763152-153763174 CTGTCTGCCTAGAGTGAAAAGGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1005281337 6:24277970-24277992 CTGTGGGCCCAGAGAAACAATGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006741537 6:36312561-36312583 CTGTGAGCCGAGAGAGAGAACGG + Intergenic
1006838928 6:37015788-37015810 CTGTGTGCCCAGGGTGATCCAGG + Exonic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1006957650 6:37889364-37889386 TTGTGTGCCAAAAGGAATAATGG + Intronic
1008991930 6:57613513-57613535 CTTGGAGCTCAGAGGGATAAGGG - Intronic
1009180532 6:60512461-60512483 CTGGGAGCTCAGAGGGATAAGGG - Intergenic
1011671568 6:89688487-89688509 GTGGGTGCCCCCAGGGATAATGG + Intronic
1011871676 6:91902112-91902134 CTCTGTGCCCAGATATATAACGG + Intergenic
1012162667 6:95905577-95905599 CTGCTTGCCTAGAGGGATAAAGG + Intergenic
1012989434 6:105910195-105910217 CTTTGTGACCTGAGGGATAGAGG - Intergenic
1013946587 6:115729112-115729134 TTGTGTTCCCAGGGGGATTATGG + Intergenic
1014068509 6:117154290-117154312 GTGTGTGGCCAGAGGGGTATGGG - Intergenic
1014083814 6:117318298-117318320 CTGTGAGCTCAGTGGGTTAATGG + Intronic
1014294848 6:119605685-119605707 CTGTGTCCCCACATGGCTAAGGG + Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1016216325 6:141607971-141607993 CTATGTTCCCAGGGGGATTATGG + Intergenic
1016947834 6:149550685-149550707 TTGTGTTCCCAGGGGGATTATGG + Intergenic
1020342850 7:7131361-7131383 CTGTGTGCCCAGTGGGCTGGAGG - Intergenic
1021159886 7:17259811-17259833 CTGTGTGCCCTGAGGGAGACAGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024300488 7:47884009-47884031 CTATGTTCCCAGATGGATCACGG - Intronic
1026847664 7:73706794-73706816 CTGTGCGCCCAGAGGTATCTGGG - Intronic
1028239200 7:88398852-88398874 CTGTTTTCCCAGAAGAATAAAGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030068430 7:105678341-105678363 CTGTGTGCCCAGAGAAATAAAGG - Intronic
1033708260 7:143909946-143909968 CTGTGTGCCAAGAGTGAGAGTGG + Intergenic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1036174133 8:6520421-6520443 CTATGTCCTCAGTGGGATAATGG - Intronic
1038790959 8:30667920-30667942 CTGTGGGCTCTGGGGGATAAGGG - Intergenic
1040448695 8:47522496-47522518 CTGTGAGCTCAGAGGGAAAGAGG + Intronic
1042146264 8:65733276-65733298 GGGTGTGCCCAGAGGGAGATGGG + Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042849838 8:73205665-73205687 CTGTGTGTTCAGGGAGATAAAGG + Intergenic
1044609357 8:94077153-94077175 CTGAGTGCCCAGAGACCTAAGGG - Intergenic
1044967571 8:97587950-97587972 CTGCGTGCCAAGAGTGATCAAGG + Intergenic
1045394242 8:101744744-101744766 CTGTGTGCCTGGAAGTATAAAGG - Intronic
1045883864 8:107073034-107073056 CATTGTTCCCAAAGGGATAAAGG + Intergenic
1048302636 8:133262691-133262713 CTGAGTGCCCAGGAGGAAAAGGG - Intronic
1048876813 8:138843134-138843156 CTATGTGCACAGTGGGAGAAAGG - Intronic
1050905865 9:11004738-11004760 CTCTGTGGCCAGAGGAATAAAGG + Intergenic
1051053330 9:12955794-12955816 TTATGTTCCCAGAGGGATTATGG + Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1052152115 9:25129786-25129808 TTGGGTGCCCAGAGTTATAATGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1056135200 9:83623639-83623661 CTGTGTGTCCAGATGGCCAAAGG - Intronic
1058114788 9:101072483-101072505 CTGTGTGCCCAGGAAGAGAAGGG + Intronic
1059158734 9:112013550-112013572 CTGTCTGCCCAGAGCAACAAAGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061419001 9:130463270-130463292 CTCTGTCCCCAGAGAGAAAATGG - Intronic
1062731342 9:138111808-138111830 CTGTGTGCCCTGAAGGTAAAAGG - Intronic
1186277589 X:7956815-7956837 CTGCTTTCCCAGAGGGATACAGG + Intergenic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189922558 X:45916719-45916741 CTGTGTTCTGTGAGGGATAAAGG + Intergenic
1190107332 X:47569810-47569832 CTGTGTGGCCAGTGGGATCTGGG + Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1193007938 X:76642266-76642288 TTATGTTCCCAGAGGGATTATGG + Intergenic
1193531790 X:82663478-82663500 CTCAGTGAGCAGAGGGATAACGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195524795 X:105874316-105874338 CTGTGTGCCCAAAGGAAGTAGGG + Intronic
1197805305 X:130393141-130393163 CTGTGAGCCCAGTGTTATAAGGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1202200928 Y:22346801-22346823 ATGTGTACCCAGAGGCATAGGGG - Intronic