ID: 999149649

View in Genome Browser
Species Human (GRCh38)
Location 5:149418254-149418276
Sequence CACACCTACATGATGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999149649_999149658 0 Left 999149649 5:149418254-149418276 CCCCACCACATCATGTAGGTGTG No data
Right 999149658 5:149418277-149418299 GGCCCTTGAGGCTCAGAGAGGGG No data
999149649_999149657 -1 Left 999149649 5:149418254-149418276 CCCCACCACATCATGTAGGTGTG No data
Right 999149657 5:149418276-149418298 GGGCCCTTGAGGCTCAGAGAGGG No data
999149649_999149656 -2 Left 999149649 5:149418254-149418276 CCCCACCACATCATGTAGGTGTG No data
Right 999149656 5:149418275-149418297 TGGGCCCTTGAGGCTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999149649 Original CRISPR CACACCTACATGATGTGGTG GGG (reversed) Intergenic
No off target data available for this crispr