ID: 999153783

View in Genome Browser
Species Human (GRCh38)
Location 5:149443732-149443754
Sequence CCTTTTCAGAAGTGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999153783_999153791 18 Left 999153783 5:149443732-149443754 CCTCCCACCCACTTCTGAAAAGG No data
Right 999153791 5:149443773-149443795 AGGCAAAGCCCAATTGAAGCAGG No data
999153783_999153790 -2 Left 999153783 5:149443732-149443754 CCTCCCACCCACTTCTGAAAAGG No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999153783 Original CRISPR CCTTTTCAGAAGTGGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr