ID: 999153790

View in Genome Browser
Species Human (GRCh38)
Location 5:149443753-149443775
Sequence GGATTTCAGATGGTTTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999153782_999153790 21 Left 999153782 5:149443709-149443731 CCAGCTCTCAGGCATCTGATGTG No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data
999153781_999153790 22 Left 999153781 5:149443708-149443730 CCCAGCTCTCAGGCATCTGATGT No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data
999153785_999153790 -5 Left 999153785 5:149443735-149443757 CCCACCCACTTCTGAAAAGGATT No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data
999153787_999153790 -9 Left 999153787 5:149443739-149443761 CCCACTTCTGAAAAGGATTTCAG No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data
999153786_999153790 -6 Left 999153786 5:149443736-149443758 CCACCCACTTCTGAAAAGGATTT No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data
999153783_999153790 -2 Left 999153783 5:149443732-149443754 CCTCCCACCCACTTCTGAAAAGG No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data
999153788_999153790 -10 Left 999153788 5:149443740-149443762 CCACTTCTGAAAAGGATTTCAGA No data
Right 999153790 5:149443753-149443775 GGATTTCAGATGGTTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999153790 Original CRISPR GGATTTCAGATGGTTTAGAA AGG Intergenic
No off target data available for this crispr