ID: 999153791

View in Genome Browser
Species Human (GRCh38)
Location 5:149443773-149443795
Sequence AGGCAAAGCCCAATTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999153788_999153791 10 Left 999153788 5:149443740-149443762 CCACTTCTGAAAAGGATTTCAGA No data
Right 999153791 5:149443773-149443795 AGGCAAAGCCCAATTGAAGCAGG No data
999153787_999153791 11 Left 999153787 5:149443739-149443761 CCCACTTCTGAAAAGGATTTCAG No data
Right 999153791 5:149443773-149443795 AGGCAAAGCCCAATTGAAGCAGG No data
999153785_999153791 15 Left 999153785 5:149443735-149443757 CCCACCCACTTCTGAAAAGGATT No data
Right 999153791 5:149443773-149443795 AGGCAAAGCCCAATTGAAGCAGG No data
999153786_999153791 14 Left 999153786 5:149443736-149443758 CCACCCACTTCTGAAAAGGATTT No data
Right 999153791 5:149443773-149443795 AGGCAAAGCCCAATTGAAGCAGG No data
999153783_999153791 18 Left 999153783 5:149443732-149443754 CCTCCCACCCACTTCTGAAAAGG No data
Right 999153791 5:149443773-149443795 AGGCAAAGCCCAATTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999153791 Original CRISPR AGGCAAAGCCCAATTGAAGC AGG Intergenic
No off target data available for this crispr