ID: 999154891

View in Genome Browser
Species Human (GRCh38)
Location 5:149451039-149451061
Sequence ACTAAAGAGGTCACGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999154888_999154891 23 Left 999154888 5:149450993-149451015 CCAGGCAAACTTCTACTTGTACT No data
Right 999154891 5:149451039-149451061 ACTAAAGAGGTCACGCAGCCCGG No data
999154887_999154891 24 Left 999154887 5:149450992-149451014 CCCAGGCAAACTTCTACTTGTAC No data
Right 999154891 5:149451039-149451061 ACTAAAGAGGTCACGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999154891 Original CRISPR ACTAAAGAGGTCACGCAGCC CGG Intergenic