ID: 999158346

View in Genome Browser
Species Human (GRCh38)
Location 5:149474441-149474463
Sequence CAGCATTCCCTCCACTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999158341_999158346 -2 Left 999158341 5:149474420-149474442 CCTGGCTCTCCCAGGTGGCTCCA No data
Right 999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG No data
999158336_999158346 13 Left 999158336 5:149474405-149474427 CCACCCTGGGACAAGCCTGGCTC No data
Right 999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG No data
999158338_999158346 9 Left 999158338 5:149474409-149474431 CCTGGGACAAGCCTGGCTCTCCC No data
Right 999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG No data
999158337_999158346 10 Left 999158337 5:149474408-149474430 CCCTGGGACAAGCCTGGCTCTCC No data
Right 999158346 5:149474441-149474463 CAGCATTCCCTCCACTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999158346 Original CRISPR CAGCATTCCCTCCACTAGGC AGG Intergenic
No off target data available for this crispr