ID: 999160589

View in Genome Browser
Species Human (GRCh38)
Location 5:149493390-149493412
Sequence ATTCTATTATGGTGCCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999160589_999160593 11 Left 999160589 5:149493390-149493412 CCTTTGTGGCACCATAATAGAAT 0: 1
1: 0
2: 1
3: 9
4: 125
Right 999160593 5:149493424-149493446 ATCTCATATTTCTCCATCCCAGG 0: 1
1: 0
2: 0
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999160589 Original CRISPR ATTCTATTATGGTGCCACAA AGG (reversed) Intronic
908846708 1:68332199-68332221 TTTCTTTTATGGTGGCAAAACGG + Intergenic
909723071 1:78798857-78798879 ATTCTATAATGTTTCCAAAAAGG - Intergenic
910855231 1:91688277-91688299 ATCCTATTCAGGGGCCACAAAGG - Intronic
911810653 1:102274766-102274788 AGTCTAATATGCTGACACAAAGG - Intergenic
916811204 1:168307221-168307243 ATTTTGTTATAGCGCCACAAAGG - Intronic
917796235 1:178534665-178534687 ATTCTCTTGTGGTCCCACCAAGG - Intronic
918580196 1:186117691-186117713 CTTTTATTCTGGTGCAACAAAGG - Intronic
919519784 1:198573371-198573393 ATTTTTATATGGTCCCACAAAGG - Intergenic
921444581 1:215230192-215230214 ACTCTATGATGTTGGCACAATGG - Intronic
923069895 1:230553349-230553371 GTTATATTTTGGTGCCAGAATGG + Intergenic
1063757300 10:9027550-9027572 TTGCTGTTATGGTGCCAGAATGG - Intergenic
1067727431 10:48780941-48780963 ATTCTAATATGCAGCCAGAATGG + Intronic
1068388170 10:56359363-56359385 TTTATATTATAGTGCCTCAAAGG + Intronic
1071864038 10:89705702-89705724 CTGCCATTATAGTGCCACAACGG - Intronic
1073840814 10:107496612-107496634 ATTCAATTTTGCTGCAACAAAGG - Intergenic
1074952497 10:118352342-118352364 ATTCTATTATGCTTCTTCAAAGG + Intergenic
1077400419 11:2353320-2353342 ATTTTATTATGGCCGCACAAAGG - Intergenic
1079074841 11:17378068-17378090 TTTCTATTATGATGCCACAAGGG + Intergenic
1079375106 11:19885438-19885460 TTTCTGTTAGGATGCCACAAGGG - Intronic
1080726844 11:34906522-34906544 TTTCTATTATGATGCAACAAGGG + Intronic
1081472276 11:43386308-43386330 ACTCTATGATGTTCCCACAATGG - Intronic
1082287643 11:50334616-50334638 ATTCTCTCTTGGTGCCACCATGG - Intergenic
1083069074 11:59958030-59958052 ATCTTATTATGGTGCCTGAATGG + Intergenic
1086613765 11:88789622-88789644 TTTTTAATATGGTACCACAAGGG - Intronic
1087297827 11:96398169-96398191 ATTCTGTTATAGTAGCACAATGG + Intronic
1091338358 11:134791258-134791280 AAGCTATTATTGTGCCAGAAAGG - Intergenic
1091473385 12:750657-750679 ATTTTTTCATGGTGCCAAAAGGG + Intergenic
1093487829 12:19671149-19671171 ATTCTATTATAGCAGCACAATGG - Intronic
1093709340 12:22312086-22312108 ATTCTAGTGTGTTGCCCCAAAGG + Intronic
1098011121 12:66053399-66053421 TTTCTATTATGTTGACACATTGG - Intergenic
1101887618 12:108680185-108680207 AGCCAATTATGGTGCCACATAGG + Intronic
1106911790 13:34470893-34470915 ATTCCATTGTTTTGCCACAATGG - Intergenic
1107057307 13:36120528-36120550 ACTCTATGATGTTCCCACAATGG + Intronic
1109548253 13:63858329-63858351 ATTCTATTATTTTGGTACAAAGG - Intergenic
1110674986 13:78231548-78231570 AAAGTATTCTGGTGCCACAAAGG - Intergenic
1116185061 14:41589916-41589938 ATTTTCTTATGGTAACACAAAGG - Intergenic
1118543018 14:66851809-66851831 ATTCTATTCTGCTGTCAAAATGG - Intronic
1127465203 15:59237534-59237556 ATTCTATCCTGGTAACACAAAGG - Intronic
1131824982 15:96313258-96313280 ATTCTCTAATGGTCCCCCAATGG - Intergenic
1131856872 15:96606375-96606397 ATTCATTCATGGTGCCTCAAAGG - Intergenic
1138157079 16:54715766-54715788 ATACAATTTTGTTGCCACAAAGG - Intergenic
1138171042 16:54849854-54849876 AATGTATTAGGTTGCCACAAAGG + Intergenic
1139046096 16:63061751-63061773 ATTCTTGTCTGGTGCCCCAAAGG + Intergenic
1139194004 16:64897154-64897176 ATTCTATTTTGCTGACAAAATGG + Intergenic
1139775669 16:69315684-69315706 TTTCTATTCTGCTGCCTCAAGGG - Intronic
1144609186 17:16694257-16694279 ATTTGTTTATGGTGCCAGAAAGG - Intronic
1144903577 17:18621272-18621294 ATTTGTTTATGGTGCCAGAAAGG + Intergenic
1144927483 17:18824713-18824735 ATTTGTTTATGGTGCCAGAAAGG - Intergenic
1145128994 17:20325453-20325475 ATTTGTTTATGGTGCCAGAAAGG - Intergenic
1145195674 17:20892164-20892186 ATTTGTTTATGGTGCCAGAAAGG + Intronic
1149283813 17:55139202-55139224 ATTCTATTCTGATGGCACAGGGG + Intronic
1152003352 17:77661465-77661487 ATTCAATTTTTGTGCCAAAAAGG + Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1156224873 18:35094751-35094773 ATCCTATTCTTGTGACACAAGGG - Intronic
1157957419 18:52113900-52113922 ATTCTATTATGATGTCTAAAGGG + Intergenic
1158325348 18:56307899-56307921 ATTCTTTTATGGTTTCACAGAGG - Intergenic
1159890288 18:73946556-73946578 ATTTTCCTATGGGGCCACAAAGG - Intergenic
1161599042 19:5169554-5169576 ATTCTCTTGTAGTGGCACAAAGG - Intronic
1166020950 19:40028741-40028763 ATTCCATTCTGATGCCAGAATGG - Exonic
1166311437 19:41965110-41965132 ATTGTGTTATAGTCCCACAATGG + Intergenic
925939800 2:8805912-8805934 ACTCTATGATGTTCCCACAATGG + Intronic
927688587 2:25190845-25190867 TCTCTAATATGGTGCCACATTGG + Intergenic
928669077 2:33581995-33582017 ATTCTTTTATGGTTTCAGAATGG + Intergenic
929034572 2:37678415-37678437 ATTTTAATATAGTGCCACAGAGG - Intronic
929240031 2:39644534-39644556 ATTCTATGATGTTTGCACAAGGG - Intergenic
929919888 2:46164497-46164519 ATTCTAGTATGATGCCAAAAGGG - Intronic
930995222 2:57708784-57708806 ATTATATGATGGTACCAAAAAGG - Intergenic
932386705 2:71340622-71340644 ATTCTATAATCTTCCCACAAAGG - Intronic
934648049 2:96070743-96070765 ACTCTATTATGTTGCCATTACGG + Intergenic
934841422 2:97626566-97626588 ACTCTATTATGTTGCCATTACGG + Intergenic
939142792 2:138376143-138376165 ATTCTATTTTGGGGAAACAATGG - Intergenic
939256509 2:139750626-139750648 CTTCTGATATGGTGCCTCAAGGG + Intergenic
939804912 2:146763486-146763508 ATTCTTTGATGGTGCCCAAAAGG + Intergenic
941086278 2:161121815-161121837 AGTCTATTATGACCCCACAATGG - Intergenic
941301554 2:163808808-163808830 ACTCTATTATGTTCACACAAGGG - Intergenic
942288956 2:174450508-174450530 ATACTTTTATGGTTCCTCAAAGG - Intronic
943553387 2:189370062-189370084 AGTCTGTTATGCTGCCACAATGG + Intergenic
944403468 2:199354831-199354853 ATTCTAATATAGGGCTACAAAGG - Intronic
945206687 2:207340440-207340462 ATTCTATTTTAGGGCCCCAAAGG - Intergenic
946419480 2:219556939-219556961 ATATTATTAGGGTGCCACCAAGG - Intronic
947855373 2:233320382-233320404 ATTGTATCATGTTGCCAGAATGG - Intronic
1170030311 20:11937480-11937502 ATTGGATTATGTTGCCACCAAGG - Intergenic
1171422980 20:25031250-25031272 ATTCTAAAATGGTGTCACCATGG - Intronic
1175598279 20:60252959-60252981 CTTCCCTCATGGTGCCACAAAGG - Intergenic
1178728720 21:35079318-35079340 ATTCTGCTATGATGCTACAATGG - Intronic
949295801 3:2520995-2521017 ATTCTAGTATGGTGACAAAAAGG + Intronic
950677053 3:14560638-14560660 CTTCTCTTTTGGTGCCACAGTGG - Intergenic
952657938 3:35808812-35808834 ATTCTATGATGTTTTCACAATGG + Intergenic
953701669 3:45200755-45200777 ATTTTATTATTGTGACACAAAGG - Intergenic
956618006 3:71192368-71192390 ATTTTAATATGGTGCCCCAGAGG + Intronic
960420853 3:117443701-117443723 ATTCTATAATGGTTCCTCATGGG - Intergenic
964572302 3:158122053-158122075 TTTCTAACATGGTGGCACAATGG - Intronic
969982892 4:11177252-11177274 ACTCTATGATGTTCCCACAAGGG + Intergenic
970258532 4:14197613-14197635 ATTCTGTTATATTGCCACCAGGG + Intergenic
971017398 4:22502548-22502570 ATTCAATCATGGTGCTACAAGGG + Intronic
971172111 4:24244065-24244087 ATTCTATTAGGAAGCCCCAAGGG - Intergenic
971459346 4:26878082-26878104 ATTCTGTTATGGCTGCACAAAGG + Intronic
973086711 4:46072263-46072285 ATTCTGTGATGTTTCCACAATGG + Intronic
975881509 4:78913630-78913652 AATCTCTTATAGTGCCCCAATGG + Exonic
982487192 4:155980241-155980263 ATTCTATTATGGATGCACACAGG - Intergenic
985987923 5:3533117-3533139 ATACTATTAGTGTACCACAATGG + Intergenic
987970381 5:24936348-24936370 ATTCTACTAGGGTCCAACAAAGG + Intergenic
988574926 5:32412638-32412660 ATTCTTTTATGTAGCCACAATGG - Intronic
988999869 5:36748925-36748947 ATCCTATTACAGTGTCACAAGGG - Intergenic
989507639 5:42245922-42245944 CTTCTATTATGCTATCACAATGG + Intergenic
991436627 5:66602742-66602764 ATTCTATAGTGTTGCCAGAAAGG + Intronic
993164723 5:84337876-84337898 ATTTTATTATGGTACAATAAAGG - Intronic
999160589 5:149493390-149493412 ATTCTATTATGGTGCCACAAAGG - Intronic
1000444146 5:161299302-161299324 AGTCAATTATGGTGTCAGAATGG - Intronic
1001098221 5:168792672-168792694 TATCTATTATTGTGCCAGAATGG - Intronic
1009905438 6:69865670-69865692 ATTATATTATTGATCCACAATGG - Intergenic
1010169436 6:72957583-72957605 ATTCTAATATGCAGCCAGAACGG + Intronic
1010728027 6:79357291-79357313 TTTCTATAATGCTGCCAGAAGGG + Intergenic
1015139605 6:129914653-129914675 ACTCTATGATGGTCACACAATGG + Intergenic
1016161471 6:140885701-140885723 ACTCTCATATGTTGCCACAAGGG - Intergenic
1023004811 7:35852722-35852744 ATTCTATTATCGTGACACAGAGG - Intronic
1024725058 7:52184553-52184575 ATTAATTTTTGGTGCCACAAAGG - Intergenic
1033399906 7:141012652-141012674 AATATATTCTGATGCCACAATGG - Intronic
1037099090 8:15020602-15020624 ATTCTATTATAGTGCAGGAAGGG + Intronic
1038724091 8:30064166-30064188 ATTCTATAGTGGGGCCACCATGG + Intronic
1040913640 8:52545892-52545914 ACTCTATGATGCTCCCACAATGG - Intronic
1041826514 8:62101129-62101151 TTTCCATTATGATGCAACAAAGG - Intergenic
1041860344 8:62505901-62505923 ATTCTTTTATGGTGACTCAAAGG + Intronic
1043445283 8:80313439-80313461 ATTCTATGATGTTCACACAATGG + Intergenic
1044015618 8:87046194-87046216 TCTCTATTATGATGCAACAAGGG - Intronic
1051380157 9:16449537-16449559 ATTCATTTACGGTGACACAATGG - Intronic
1055479385 9:76694809-76694831 ATTCTATTATGTTGAAAAAAAGG + Intronic
1059727047 9:117019336-117019358 ATTATTTTATGATGCTACAAAGG + Intronic
1188696434 X:33197553-33197575 GCTATATAATGGTGCCACAATGG - Intronic
1189884750 X:45530637-45530659 ATTTTTTTAAAGTGCCACAAAGG + Intergenic
1194581692 X:95680252-95680274 ATCTTATTTTAGTGCCACAATGG + Intergenic
1195236177 X:102900768-102900790 GTTCTATAATGGTGGTACAATGG + Intergenic
1195516360 X:105780651-105780673 ATTCTGATATTGTGCCTCAAAGG + Intergenic
1196252387 X:113477219-113477241 ATTCAATGATGGTGCAACATAGG - Intergenic
1199367743 X:147006953-147006975 ATTATATTACTGTTCCACAACGG + Intergenic
1199634000 X:149798256-149798278 TTTCTAATATGGTGCCATAGAGG + Intergenic