ID: 999160651

View in Genome Browser
Species Human (GRCh38)
Location 5:149494295-149494317
Sequence GAGGATAAGCACAACCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999160647_999160651 2 Left 999160647 5:149494270-149494292 CCAAATATTCATTTGTAAGCCAT 0: 1
1: 0
2: 1
3: 27
4: 257
Right 999160651 5:149494295-149494317 GAGGATAAGCACAACCATATGGG 0: 1
1: 0
2: 0
3: 6
4: 106
999160646_999160651 5 Left 999160646 5:149494267-149494289 CCTCCAAATATTCATTTGTAAGC 0: 1
1: 0
2: 1
3: 21
4: 237
Right 999160651 5:149494295-149494317 GAGGATAAGCACAACCATATGGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999160651 Original CRISPR GAGGATAAGCACAACCATAT GGG Intronic
900794206 1:4698286-4698308 GAGAATAAGCACAGCCCTAGAGG - Intronic
906350749 1:45056808-45056830 GAGGAGAAGGCAAACCATATGGG + Intronic
915238072 1:154500621-154500643 GAAGATAAAAACAACCAGATCGG + Intronic
917955246 1:180089814-180089836 GAGGATAAGCACATATATAGTGG + Intronic
918176265 1:182048393-182048415 GAGCATAAGCAGAACCACTTAGG + Intergenic
921871475 1:220145205-220145227 GAGGATAATAAACACCATATAGG + Intronic
922281219 1:224126170-224126192 GAGAATAAGAATAACCAGATAGG - Intronic
923464216 1:234233757-234233779 GAGGATAATCCCAACTTTATTGG + Intronic
1064466819 10:15591700-15591722 AATGATAAGCAGAGCCATATAGG - Intronic
1065464461 10:26004174-26004196 GATGAGAAGCACATCCATGTAGG + Intronic
1065869981 10:29947864-29947886 CAGGATAAGTACAACTATTTGGG - Intergenic
1068463289 10:57354648-57354670 GAGAATAACCACAAACATATTGG - Intergenic
1071588621 10:86849625-86849647 GTGGCTAATGACAACCATATCGG - Intronic
1072170930 10:92861129-92861151 GTGGAGAAGCACAAACATAAGGG - Intronic
1073596018 10:104800896-104800918 GAGGATCAGCCCAACCATCAGGG - Intronic
1079026429 11:16951654-16951676 GAGGCAATGCAAAACCATATGGG + Intronic
1080396461 11:31894558-31894580 GAGGAAAAGAAGAACCCTATTGG + Intronic
1091325411 11:134683313-134683335 GTGGATAAGCACAATTATCTGGG + Intergenic
1097102141 12:56597263-56597285 GAAGAAAAGCACAACTAAATGGG + Exonic
1100770275 12:97913902-97913924 GAAGAAAAACACAACCATACTGG + Intergenic
1106442239 13:29786222-29786244 GAGAATAAGCAGGTCCATATAGG - Intronic
1109926994 13:69156210-69156232 GAGGAAAATCACGACGATATTGG + Intergenic
1112728171 13:102329040-102329062 GAGGATGTACAGAACCATATGGG - Intronic
1113304029 13:109057305-109057327 GAAGATAAGCAGAACCACATGGG + Intronic
1126501376 15:49349494-49349516 GAGAATAAGCATAAAAATATTGG - Intronic
1131027844 15:89159963-89159985 GAGGATAAGCTCAAACAAATAGG + Intronic
1131387736 15:92021127-92021149 GACAACAAGCACAACCATACAGG - Intronic
1131565842 15:93484635-93484657 GAGGATAGGCAGAACCAAAATGG + Intergenic
1134245758 16:12538729-12538751 CAGGAGAAGCACACCCATATGGG + Intronic
1135931676 16:26743386-26743408 GAGGACAAACACTACCATGTGGG - Intergenic
1138001123 16:53280957-53280979 GAGAAAAAGGACAACCAGATGGG - Intronic
1138901632 16:61276991-61277013 GAGGATAAGAAAAACCTTTTCGG - Intergenic
1139009507 16:62614715-62614737 AAGGATATGCACACACATATAGG - Intergenic
1147466506 17:40615093-40615115 AAGGGTGAGCACTACCATATCGG - Intergenic
1148752996 17:49956435-49956457 GATGATAAACACACACATATTGG + Intergenic
1150889329 17:69128733-69128755 AAGGAGAAACACAACCAAATTGG + Exonic
1152540034 17:80970225-80970247 GAGGAAGAGCCCAACCACATGGG + Intergenic
1155360307 18:24993004-24993026 GAGGAGAAGCACTGACATATGGG + Intergenic
1155471913 18:26200374-26200396 AATGAAAAGCAAAACCATATTGG - Intergenic
1158179341 18:54696225-54696247 GAGAATATGCACAACAAAATTGG + Intergenic
1164734321 19:30529593-30529615 GAGGATAAGAACAAGCGAATGGG + Intronic
1164777268 19:30862598-30862620 GAGGAAAAGCTCACCCATTTGGG + Intergenic
928739714 2:34336540-34336562 GAGCAAATGAACAACCATATGGG + Intergenic
929982483 2:46694691-46694713 GATGATTAGCTCAACCATATGGG + Intergenic
931157677 2:59653863-59653885 GAGGACAGGCCCAACCAGATGGG - Intergenic
940576164 2:155506944-155506966 AAGGATAAGAAGAACAATATTGG + Intergenic
945576226 2:211532610-211532632 GATGATAACCACAATCAAATGGG + Intronic
948427041 2:237894909-237894931 AAGGAGAACCACAACCAGATAGG - Intronic
1172571506 20:35974454-35974476 GAGGCTAAGCCTAACCACATTGG + Intronic
1173575125 20:44108066-44108088 GAGGTTAAGTTCAACCATGTGGG + Intergenic
949410261 3:3755802-3755824 GTGGCTAATGACAACCATATTGG - Intronic
951157209 3:19370234-19370256 GAGGATACACACAAGCAAATAGG - Intronic
951363859 3:21756660-21756682 GAGCAAAAGCACAAGTATATGGG + Intronic
956307016 3:67836711-67836733 TAGGATAGGCAAACCCATATTGG - Intergenic
963471993 3:145752191-145752213 GAGGATCAGCACAGCCTTCTGGG - Intergenic
972869153 4:43274580-43274602 GTGAATAACCACAACCATAATGG + Intergenic
973653478 4:53021145-53021167 AATGATAAGCACAAACTTATTGG + Intronic
974151431 4:58015154-58015176 GAGGATAAGCAAAATCGAATGGG + Intergenic
975248674 4:72150760-72150782 GAGGAAAAACACAACAATCTAGG - Intergenic
977875185 4:102141270-102141292 GAGGATAAGCACAAGTGTAACGG - Intergenic
978213895 4:106174049-106174071 TATGATAAACACAACCATTTGGG + Intronic
980145357 4:128976817-128976839 CAAGATAAGCACAAGCATAAAGG + Intronic
983307950 4:166017865-166017887 CAGGATAAGGACAATGATATTGG + Intronic
983463140 4:168051388-168051410 TAGGATAAGCACATCAATTTCGG + Intergenic
986541185 5:8845243-8845265 AATGATAAGCACTCCCATATGGG - Intergenic
989685673 5:44083961-44083983 GTGTATAAGCACAAACATTTTGG + Intergenic
993497992 5:88629681-88629703 GAGTATAAACACAACCATTCTGG + Intergenic
995721426 5:115138567-115138589 GGGGATAAGAAAAACCATTTAGG + Intronic
996277896 5:121690234-121690256 TAGAATAAGCACAACTATTTTGG - Intergenic
996781872 5:127196095-127196117 GAGGATATGAACAACATTATCGG + Intergenic
999160651 5:149494295-149494317 GAGGATAAGCACAACCATATGGG + Intronic
1001652249 5:173324213-173324235 TAGGATAAGCACAATCAGACGGG - Intronic
1004731189 6:18360749-18360771 GAGAATAAGCACAACAAGTTTGG - Intergenic
1007638704 6:43318384-43318406 GAGGAAAAGCCCAATCATTTTGG - Intronic
1008684690 6:53911901-53911923 GAGAATATGCTCAGCCATATGGG + Intronic
1012593724 6:101015873-101015895 GAGGATAACTACAACTTTATAGG + Intergenic
1015287230 6:131500228-131500250 GAGGACAAGCTCCACGATATTGG - Intergenic
1016404148 6:143712792-143712814 GAGTAGAGGCACAACCCTATTGG + Intronic
1018494314 6:164333273-164333295 GAGGATAAGCACAAGCAACAAGG + Intergenic
1028479571 7:91290005-91290027 GAGGTTGAGCTCAACAATATGGG + Intergenic
1028610618 7:92706572-92706594 GAAGAAAAGCACAACCATGAAGG + Intronic
1030941699 7:115658779-115658801 TAGGATAAACAAAACCATGTTGG - Intergenic
1033131200 7:138747029-138747051 GTGGATAAGCACAAACAAATTGG + Intronic
1033676401 7:143543585-143543607 CAGGAGAATGACAACCATATGGG - Intergenic
1033695432 7:143785854-143785876 CAGGAGAATGACAACCATATGGG + Intergenic
1043723096 8:83572709-83572731 GAGGATAGGAGCAACCAAATAGG + Intergenic
1048019185 8:130522682-130522704 GATGATCAGCAAAACCATGTAGG - Intergenic
1050847370 9:10238997-10239019 TAGGATATTCAAAACCATATTGG - Intronic
1058698027 9:107576284-107576306 GAGGAAAAGCTCAACAATTTAGG + Intergenic
1060869142 9:127025497-127025519 GAGGATCAGAACAGCCATTTAGG - Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1062694025 9:137863271-137863293 GAGGGTAATCCCCACCATATAGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1187823181 X:23309605-23309627 GAGTATAAGCACGATTATATGGG - Intergenic
1190567475 X:51744932-51744954 GTGGATAAGTACAAAGATATGGG + Exonic
1193987223 X:88258571-88258593 CAGGATAAACACATCAATATAGG - Intergenic
1194390964 X:93317429-93317451 TAGCATAAGCTCAGCCATATTGG + Intergenic