ID: 999168505

View in Genome Browser
Species Human (GRCh38)
Location 5:149572285-149572307
Sequence TACATCCCATGTTACATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999168505_999168506 21 Left 999168505 5:149572285-149572307 CCTCTTATGTAACATGGGATGTA 0: 1
1: 0
2: 2
3: 16
4: 205
Right 999168506 5:149572329-149572351 TAAATATTGTTAACTTTACATGG 0: 1
1: 0
2: 4
3: 47
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999168505 Original CRISPR TACATCCCATGTTACATAAG AGG (reversed) Intronic
900732639 1:4272306-4272328 TACCTCCCAGGTTACGTGAGAGG - Intergenic
903345602 1:22682325-22682347 GACATCCCATTTTACAGAGGAGG + Intergenic
905861741 1:41356693-41356715 TCCTTCCCATGGTACAGAAGGGG + Intergenic
907060557 1:51418809-51418831 ATTATCCCATGTTACAGAAGAGG + Intronic
907282255 1:53358458-53358480 TATCTCCAATGCTACATAAGTGG - Intergenic
907297708 1:53465988-53466010 TACGTCTCATTTTACAGAAGGGG + Intronic
907972012 1:59392361-59392383 TACATCACAAGATACAGAAGTGG + Intronic
908045529 1:60163886-60163908 TAGACCCCATGTGAAATAAGTGG - Intergenic
908469029 1:64423876-64423898 TACATCCCATGTTCCCTTTGGGG - Intergenic
908827766 1:68149936-68149958 TACATCCCATTTTATAGATGAGG + Intronic
910911836 1:92243128-92243150 TTACTCCCATGTTACAGAAGAGG + Intronic
912102872 1:106233546-106233568 TAGATCCCATGTTAGAGCAGAGG - Intergenic
913154186 1:116078367-116078389 AACATTTCATGTTACATATGAGG - Intergenic
913465335 1:119135551-119135573 TTCATCCCATTTTATAAAAGAGG - Intronic
915698778 1:157770810-157770832 TTCATCCCATGTTTCCTGAGGGG + Intronic
920658686 1:207896948-207896970 TACATCCCATGCAACAGAAGAGG + Intronic
920801311 1:209190428-209190450 TCCATCCCAGCATACATAAGAGG - Intergenic
922778142 1:228226965-228226987 TGAATCCCATGTTACAGATGAGG - Intronic
923821000 1:237441311-237441333 TACATCCAATTTTTCCTAAGGGG - Exonic
1064395264 10:14976499-14976521 TACAAACCCTGTGACATAAGAGG - Intronic
1064395540 10:14979108-14979130 TACACCCCATGTGACATAGGAGG - Intronic
1064396308 10:14984609-14984631 TACAAACCCTGTGACATAAGAGG - Intronic
1064398047 10:14996836-14996858 TACAAACCCTGTGACATAAGGGG - Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1069291626 10:66787206-66787228 TACACGCCATCTTACAGAAGAGG - Intronic
1069681256 10:70287154-70287176 TAAATCCCATTTTACAAATGAGG - Intergenic
1069710362 10:70483872-70483894 TACATCCCGTGTAACAGAAAGGG - Intronic
1072734339 10:97868969-97868991 TATTTCCCATTTTACATATGGGG + Exonic
1076213017 10:128665914-128665936 TAAATCCAATGTAAGATAAGAGG + Intergenic
1077473057 11:2773578-2773600 AACATCCCATCTTCCAAAAGGGG + Intronic
1077473113 11:2773944-2773966 AGCATCCCATATTACAGAAGGGG + Intronic
1079040709 11:17056910-17056932 TACACCCCCTGTGACATTAGAGG + Intergenic
1082235360 11:49816307-49816329 TACACCCCGTGTGACATTAGGGG - Intergenic
1083291655 11:61693893-61693915 CTCCTCCCATTTTACATAAGAGG + Intronic
1085317900 11:75556994-75557016 CATATCCCATGTTACAGATGAGG + Intergenic
1086701339 11:89903201-89903223 TACATTCCCTGTGACATTAGAGG + Intergenic
1086704828 11:89941324-89941346 TACATTCCCTGTGACATTAGAGG - Intergenic
1087457196 11:98402226-98402248 TATATTCCATTTTACATAAAAGG + Intergenic
1088226051 11:107621561-107621583 AACATCCCATTTTACAAAGGAGG + Intronic
1094082148 12:26548670-26548692 TACATCACATCTTGCATAAATGG + Intronic
1095145770 12:38724097-38724119 TACTTCCCATTTTAGATAAAAGG + Intronic
1096504994 12:52087143-52087165 TACTTCCCATGGAAAATAAGTGG + Intergenic
1096508373 12:52111914-52111936 TACACCCCCTGTGACATTAGAGG + Intergenic
1097421020 12:59379409-59379431 CACATCACATGTTACTTAGGGGG - Intergenic
1097920369 12:65066115-65066137 GACATCTCATATTACATAACGGG - Intronic
1098007509 12:66013960-66013982 TTGATCCCATGTTATATATGGGG - Intergenic
1099146720 12:79055059-79055081 TACATCCCATAGTTAATAAGTGG - Intronic
1101237911 12:102808120-102808142 TAGATCCCATGATAGATAATGGG - Intergenic
1101879094 12:108614325-108614347 AGCATCCCATGTTACAGATGAGG + Intergenic
1104151924 12:126091936-126091958 TCCTTGCCATGTCACATAAGAGG + Intergenic
1106488660 13:30195386-30195408 TACATCTCATGATCCAAAAGAGG + Intergenic
1107545387 13:41428973-41428995 TACAAACCCTGTGACATAAGGGG - Intergenic
1108052862 13:46463402-46463424 TACAAACCCTGTGACATAAGGGG + Intergenic
1108431067 13:50354251-50354273 TACATTCCATGGTACAGATGTGG - Intronic
1109356223 13:61232376-61232398 TAAATCACACCTTACATAAGTGG + Intergenic
1109538648 13:63744900-63744922 TACACGCCATGTGACATTAGGGG + Intergenic
1109545187 13:63834869-63834891 TACACGCCATGTGACATTAGGGG - Intergenic
1110128788 13:71980572-71980594 TACATCCCATGTTTCTCAAAGGG - Intergenic
1110615672 13:77539287-77539309 TACATAGCATATTACATAATGGG + Intronic
1111029004 13:82571343-82571365 TACTTACCATGTTACAGAACTGG - Intergenic
1111221325 13:85208585-85208607 TACATCCTATGATATCTAAGTGG - Intergenic
1112173249 13:96994750-96994772 TCCATCCCACGCTAAATAAGAGG - Intergenic
1112182007 13:97092551-97092573 TACCTCCCATATTTCTTAAGTGG + Intergenic
1112608309 13:100929846-100929868 TACATCCCATGTTCACTTAGGGG + Intergenic
1112918706 13:104582995-104583017 TATATCACATTTTACAAAAGAGG + Intergenic
1113147102 13:107219289-107219311 TACAGGCCAGGTTAAATAAGTGG - Intronic
1113684705 13:112274807-112274829 TACATCTTATGTTACATAACAGG - Intergenic
1115320405 14:32075021-32075043 AACATTCCAACTTACATAAGTGG + Intergenic
1117008425 14:51445894-51445916 TACATAGCATGTTACATACCAGG + Intergenic
1117037638 14:51744406-51744428 TACAAACCCTGTGACATAAGGGG - Intergenic
1118590515 14:67397446-67397468 TTCATCCCATTTTACAGATGAGG + Intronic
1118906983 14:70030348-70030370 CACATCCCGTGTAACATAAGTGG + Exonic
1121126970 14:91414289-91414311 TACGTCCCATTTTACAGATGAGG + Intronic
1122225803 14:100278420-100278442 TACATCCCATGTAACAGAAAGGG + Exonic
1202850595 14_GL000225v1_random:15503-15525 TACATCACATGTTTGATCAGTGG + Intergenic
1124558630 15:30750169-30750191 TACATGCCATGTGAGAGAAGGGG - Intronic
1124672621 15:31655461-31655483 TACATGCCATGTGAGAGAAGGGG + Intronic
1126094401 15:45077830-45077852 AACACCCCATTTTACACAAGGGG + Intergenic
1126485421 15:49175121-49175143 TACATCCCATGTTCCCTTCGTGG + Intronic
1126778610 15:52119660-52119682 CCCATCCCATGTTACAAATGGGG + Exonic
1127859534 15:62981602-62981624 AACATCCCATGATACAAGAGTGG - Intergenic
1128274770 15:66344009-66344031 AAAACCCCATGTTTCATAAGTGG - Intronic
1130306364 15:82714538-82714560 TACTTCCCATTTTACAGATGGGG + Intergenic
1132235379 15:100216139-100216161 TTCATCTCATCTTACAAAAGGGG - Intronic
1134452930 16:14374405-14374427 TACATCCCACTTTGCAGAAGAGG + Intergenic
1134774522 16:16840399-16840421 TACATGCATTTTTACATAAGTGG + Intergenic
1138489746 16:57369853-57369875 TGCATCCCATTTTACATATAGGG + Intergenic
1138510593 16:57506511-57506533 CACATCCCGTGTTACACAGGTGG + Intergenic
1140507313 16:75481976-75481998 CACATCCCATCCTACAGAAGTGG - Intronic
1141014569 16:80436980-80437002 TAAATCCCATGTCACAGAAATGG - Intergenic
1145853853 17:28133259-28133281 TTATTCCCATGTTACAGAAGAGG + Intronic
1147730020 17:42593866-42593888 CACATCACATGTTACTTAGGGGG - Intronic
1148853350 17:50565442-50565464 TACATCCCATGTTACCCTAGGGG + Intronic
1149190196 17:54051598-54051620 TAATTCCCATGTTTCATGAGAGG - Intergenic
1154223218 18:12475614-12475636 TACATCCCATGTCACATTACAGG - Intronic
1155658360 18:28218317-28218339 TACCTCCCATTTTATATAAGAGG - Intergenic
1158203943 18:54970196-54970218 TACAGCCCTTGTTACACCAGAGG + Intergenic
1159769001 18:72526810-72526832 TAAATCCCATGTGTCATGAGAGG + Intergenic
1160329936 18:77982118-77982140 TTCCTCCCATGTTACTGAAGAGG - Intergenic
1161192419 19:2965690-2965712 TAAATCCCATTTTACATAGGAGG - Intergenic
1162532899 19:11246021-11246043 TACATCTCATTTTGCAAAAGGGG + Intronic
1163477074 19:17532729-17532751 AACATCCCATTTCACAGAAGTGG - Intronic
1165494429 19:36143366-36143388 TATATTCCATTTTACAGAAGAGG + Intronic
931636801 2:64348306-64348328 AGCATCCCATTTTACACAAGAGG + Intergenic
932348734 2:71014371-71014393 TACAGCCCCTGTGACATTAGAGG + Intergenic
935587923 2:104818190-104818212 TATATATCATTTTACATAAGTGG + Intergenic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
938514167 2:131984965-131984987 TAATTCCCATGTTTCATGAGAGG - Intergenic
939315769 2:140547639-140547661 TACTTCCTATATTACATAACAGG - Intronic
941026924 2:160466903-160466925 ATCATCCCATTTTACATAAGAGG - Intronic
941275597 2:163486852-163486874 TGCATCCTATGTTGCAAAAGAGG - Intergenic
943812755 2:192209921-192209943 TACAATCCATTTTACATGAGGGG - Intergenic
944738089 2:202586468-202586490 CACATCCCCTGTGACATTAGGGG - Intergenic
945408995 2:209487032-209487054 TGCATTTCATGTTACATAAAAGG - Intronic
946487182 2:220111990-220112012 TTAGTCCCATGATACATAAGAGG - Intergenic
946730843 2:222707916-222707938 GTCATCCCATGTCACATACGAGG - Intronic
947168430 2:227286542-227286564 ATCATCCCATTTTACATACGGGG + Intronic
1169394480 20:5217540-5217562 CAGATTCCATGTTACACAAGGGG + Intergenic
1172182679 20:33013149-33013171 TTCATCCCATTTTACAGATGAGG - Intronic
1172471076 20:35196480-35196502 AAAATCACATGTTACATATGGGG + Intergenic
1172665135 20:36593778-36593800 AACACCCCATTTTACATAATGGG - Exonic
1177821194 21:26032543-26032565 TCCATCCCATGTTAAAGATGAGG - Intronic
1179524858 21:41969197-41969219 TTCCTCCCATGTTACAGATGAGG - Intergenic
1181170598 22:21006968-21006990 TTCATTACATGTTACATAGGAGG - Intergenic
1181733933 22:24867324-24867346 TAATTCCCATGTTACAGATGGGG - Intronic
1182114274 22:27746266-27746288 TTCATCCCATGTCACAGATGAGG - Intergenic
1184617376 22:45647130-45647152 TCCATCCCATCTTTCAGAAGTGG + Intergenic
949176390 3:1068077-1068099 TATATCCAATGTTATAAAAGAGG - Intergenic
949615010 3:5743997-5744019 TACAGCTTATGTTATATAAGAGG - Intergenic
949882277 3:8671434-8671456 TACAAACCCTGTGACATAAGAGG + Intronic
949886122 3:8695651-8695673 TACACCCCATGTGACATTAAGGG + Intronic
949886303 3:8697354-8697376 TACACCCCCTGTGACATTAGAGG + Intronic
949886514 3:8699216-8699238 TACACCCCGTGTGACATAGGAGG + Intronic
955407513 3:58634782-58634804 TACATCCCATTCTACAGATGGGG + Intronic
956008195 3:64802965-64802987 TTTATCCCATGTTACACATGTGG - Intergenic
956197657 3:66669416-66669438 TTATTCCCATGTTACAGAAGAGG + Intergenic
957386857 3:79507197-79507219 TACATCCCTTGTGACCTAATAGG + Intronic
960501083 3:118439249-118439271 AATACCCCATGTTACAGAAGTGG + Intergenic
961270836 3:125686920-125686942 TACACCCCATGTGACATTAAGGG + Intergenic
961271109 3:125689464-125689486 TACACCCCATGTGACATAGGAGG + Intergenic
961955332 3:130795941-130795963 TTCATCCCGTATTACATAAATGG + Intergenic
965371977 3:167874375-167874397 TCCATCCCATTTTACAGATGAGG - Intergenic
965823179 3:172705416-172705438 TACATCCCATGTTACATGATGGG - Intronic
968976605 4:3825304-3825326 TAGGTCCCATGTTCCAAAAGTGG - Intergenic
969025931 4:4172231-4172253 TACACCCCCTGTGACATAAGGGG - Intergenic
969825799 4:9757567-9757589 TACACCCCGTGTGACATTAGAGG + Intergenic
969825830 4:9757881-9757903 TACACGCCATGTGACATTAGGGG + Intergenic
969825846 4:9758069-9758091 TACAAACCCTGTGACATAAGGGG + Intergenic
970363891 4:15338517-15338539 TACATCCAAGGTCACATAACTGG + Intergenic
970719271 4:18967355-18967377 AACTTCCCCAGTTACATAAGAGG - Intergenic
972213450 4:36866902-36866924 TACTTCCTAAGTTAAATAAGGGG - Intergenic
972992113 4:44833391-44833413 TACTTCCCATTTTACAGATGAGG - Intergenic
975489469 4:74972961-74972983 AACATCACATGGTAGATAAGGGG - Intronic
976951286 4:90834740-90834762 TACATCCCATGTAACGGAAAGGG + Intronic
977129628 4:93218995-93219017 TAATTCCCATGTATCATAAGAGG - Intronic
977721096 4:100241367-100241389 TTCATCCCATGTTAAAAAAATGG + Intergenic
977740909 4:100481131-100481153 TATATACCATGTTAGTTAAGAGG + Intronic
979439127 4:120730205-120730227 AATATTCCATGTTACAGAAGAGG - Intronic
979793873 4:124819697-124819719 TACATACCTTGTGACATAAATGG - Intergenic
979924314 4:126541384-126541406 TACTTCCCATGTTGAATTAGAGG - Intergenic
980478186 4:133347887-133347909 TACAACCCATGCTACAGAAAAGG + Intergenic
985190911 4:187371702-187371724 TCCATCTCATGTCACTTAAGTGG - Intergenic
987335398 5:16894225-16894247 TACATCCAATGTCCCAGAAGGGG - Intronic
988340571 5:29965156-29965178 TACAAGCAATGTTACATAATAGG + Intergenic
988449065 5:31321474-31321496 AAAACCCCATTTTACATAAGAGG - Intronic
992013614 5:72555099-72555121 AACAACCCATTTTACAGAAGAGG - Intergenic
992669410 5:79043812-79043834 TACTTCCCATGCTACATAAGTGG - Intronic
993647535 5:90478532-90478554 AACCTCCCATTTTACAGAAGAGG - Intronic
995128138 5:108600580-108600602 GACTTCCCATTTTTCATAAGAGG - Intergenic
995238781 5:109861611-109861633 TTCATCCCATCTTACAGAATAGG + Intronic
995445004 5:112232808-112232830 TACATACCATTTTACAGATGAGG - Intronic
996786151 5:127238540-127238562 GACATCCCATGTTACAGATGTGG + Intergenic
997815471 5:137013003-137013025 TTCATTTCATGTTACAAAAGTGG - Intronic
999168505 5:149572285-149572307 TACATCCCATGTTACATAAGAGG - Intronic
999429188 5:151511364-151511386 TACATCACATGCAACATGAGCGG - Intronic
999832572 5:155334897-155334919 TCCATCCCATGTTGTAGAAGAGG + Intergenic
1001213194 5:169830193-169830215 TTCTTCCCATGTTACAAATGAGG - Intronic
1002552299 5:180004018-180004040 AATATCCCATTTTACAGAAGAGG + Intronic
1010417038 6:75624151-75624173 CACCTCCCATGTTACACAATTGG + Intronic
1020199844 7:6071084-6071106 TATATCTTTTGTTACATAAGAGG + Intergenic
1022557146 7:31309771-31309793 TACACTCCATTTTACATAACAGG + Intergenic
1026127588 7:67593151-67593173 TATTTCCCATTTTACAGAAGAGG - Intergenic
1026418333 7:70206517-70206539 AACATCCCAGGTTACTTAAGAGG - Intronic
1026659073 7:72283171-72283193 TAAAACCCATTTTACAGAAGAGG - Intronic
1028116968 7:87009118-87009140 TACATACCATGTCTCATAGGTGG - Intronic
1029079659 7:97962411-97962433 TACACCCCCTGTGACATTAGAGG - Intergenic
1029333421 7:99879389-99879411 TACATCTTATGTTAGATACGGGG - Intronic
1029362856 7:100100088-100100110 TACATTTCATGTTACAGAAAAGG - Exonic
1030165245 7:106548047-106548069 TACATCCTATTTTAAAAAAGAGG + Intergenic
1030889980 7:114987538-114987560 TCCATCCCATGTTACAATAATGG + Intronic
1031271286 7:119652734-119652756 TAATTCCCATGTGTCATAAGAGG - Intergenic
1031871020 7:127090416-127090438 CACATCTCATGTTACATACCTGG + Intronic
1032774790 7:135100884-135100906 TTATTCCCATGTTACATAAGGGG - Intronic
1034346441 7:150388211-150388233 TAATTCCCATTTTACAAAAGAGG - Intronic
1036907210 8:12717198-12717220 TACACCCCCTGTGACATTAGGGG - Intergenic
1036907464 8:12719597-12719619 TACACCCCATGTGACATTAAGGG - Intergenic
1039185650 8:34913158-34913180 TTCATGCCATGTTAAAGAAGAGG + Intergenic
1039265218 8:35816368-35816390 TACATCCCATGCCACCTAACTGG + Intergenic
1041177843 8:55215180-55215202 TTCATCCCCTGTGACATTAGGGG + Intronic
1041178079 8:55218248-55218270 TATATCACTTGTTACAAAAGTGG - Intronic
1045169722 8:99651162-99651184 TACTTCCCAGGATAAATAAGTGG + Intronic
1046414355 8:113892302-113892324 TACATCCTATGTGGCAGAAGGGG - Intergenic
1046775076 8:118155558-118155580 TACAGTCCAGGTTACATCAGTGG - Intergenic
1048064790 8:130956841-130956863 CACATCCCATCTTACATGAATGG - Intronic
1048235809 8:132689184-132689206 ATCATCCCATTTTACAAAAGAGG - Intronic
1048838509 8:138544275-138544297 TACTTCCCAAGTTCAATAAGAGG + Intergenic
1048896201 8:138994625-138994647 TACATCTTATGTTACATAATAGG + Intergenic
1051065504 9:13097549-13097571 TACTTCCCATGATACTTAGGAGG - Intergenic
1056864650 9:90219037-90219059 TACATGCCGTGTGACATTAGGGG + Intergenic
1058150427 9:101457805-101457827 TACATCCAGTGTTACAAAAAAGG - Intergenic
1058774541 9:108270789-108270811 TAAATCCCATGACACAGAAGTGG - Intergenic
1059010065 9:110448003-110448025 TAAGTTACATGTTACATAAGTGG - Intronic
1059941516 9:119364711-119364733 TACAGCCCCTTTTACAGAAGAGG - Intronic
1060280497 9:122212936-122212958 GACATCCCAGGTTACAGATGAGG + Intronic
1186500797 X:10048869-10048891 ACCATCCCATGTTACCTAGGAGG - Intronic
1189220234 X:39365570-39365592 TACATCGGATGTGACATATGGGG + Intergenic
1190746369 X:53324976-53324998 TACCTCCCATCTTACAGATGAGG + Intergenic
1191940488 X:66475216-66475238 TACATTCCATTTTACAGATGAGG + Intergenic
1193334215 X:80268768-80268790 CACCTCCCATTTTACAGAAGAGG - Intergenic
1195321135 X:103723000-103723022 TAATTCCCATTTTACAGAAGGGG - Intronic
1196898817 X:120363175-120363197 TAACTCCCTGGTTACATAAGTGG - Intronic
1196927482 X:120647784-120647806 TAATTCCCATATTACATATGAGG - Intergenic
1198216218 X:134557036-134557058 TACATCTCCTGATACATAATAGG - Intergenic