ID: 999168709

View in Genome Browser
Species Human (GRCh38)
Location 5:149574489-149574511
Sequence GGTGAACACAACCAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999168709 Original CRISPR GGTGAACACAACCAAGGGGC AGG (reversed) Intronic
900339834 1:2182775-2182797 GGAGCACACACCTAAGGGGCGGG + Intronic
901878548 1:12180863-12180885 AGTGGACAAAACCCAGGGGCCGG - Intronic
902233695 1:15044275-15044297 GCAGAACACAAGCAGGGGGCAGG + Intronic
902609077 1:17586716-17586738 GGGGAGTACAAACAAGGGGCAGG + Intronic
906689379 1:47782646-47782668 GAGGAGCACCACCAAGGGGCAGG - Intronic
909531953 1:76691925-76691947 GGAGAACACCACCAAAGGGATGG + Intergenic
912499170 1:110110583-110110605 GGTGAAGATACCCATGGGGCCGG - Intergenic
919134374 1:193489655-193489677 GGTGAACACATCCACATGGCTGG + Intergenic
919821471 1:201475642-201475664 GGGGAACACAAAAAAGGGGCTGG + Intergenic
920338702 1:205262057-205262079 GGTAAACAGAGCCAAGGAGCTGG - Intronic
922705464 1:227788167-227788189 GGTGAGCACGACACAGGGGCGGG + Intergenic
923723988 1:236490622-236490644 GATGAACACATCCACGGGACGGG - Intergenic
1062768919 10:84800-84822 AGTCAACACACCCAAGGGGTGGG + Intergenic
1067000703 10:42610048-42610070 AGTCAACACAAGCAAGGGGAAGG + Intronic
1073052224 10:100674749-100674771 TTTGAACACAGGCAAGGGGCAGG + Intergenic
1073178113 10:101568901-101568923 GGTGATCTCAAACAAGGGGAGGG + Intergenic
1075132788 10:119754733-119754755 GGTGCTCACAGGCAAGGGGCTGG - Intronic
1075875749 10:125804306-125804328 GGTGAACACATCCATGTGCCAGG + Intronic
1075932546 10:126311709-126311731 GGTGAACACATCCATGTGCCAGG + Intronic
1076345677 10:129777487-129777509 GGAGAACACAGCCACGGAGCTGG - Intergenic
1076822047 10:132944248-132944270 GCTGAACACATCCACGGGCCAGG - Intergenic
1076858707 10:133129631-133129653 TGTGATCACAAGGAAGGGGCAGG - Exonic
1076858714 10:133129656-133129678 TGTGATCACAAGGAAGGGGCAGG - Exonic
1076858721 10:133129681-133129703 TGTGATCACAAGGAAGGGGCAGG - Exonic
1078541609 11:12217752-12217774 GGTGAAGACAAGCATGGGCCTGG - Intronic
1081553200 11:44133027-44133049 GGTGATCACAACTGAGGGGAGGG - Intronic
1082065882 11:47899913-47899935 GGCCGACACATCCAAGGGGCAGG - Intergenic
1083581510 11:63828044-63828066 GGTGCTCACAACCAGGGAGCTGG + Intergenic
1084715758 11:70872523-70872545 GGTGCAAACGACCAAGTGGCTGG + Intronic
1090137258 11:124210605-124210627 GGGGACCACCACGAAGGGGCTGG - Intergenic
1091700774 12:2660135-2660157 GGTGGACACAACCACAGGTCAGG - Intronic
1091827569 12:3524445-3524467 GGTGAGGGCAACTAAGGGGCGGG - Intronic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1094141116 12:27182886-27182908 GGTGAACACATCCAAGTGCTGGG + Intergenic
1095367995 12:41431011-41431033 GGAGAACAGTACCAAGGGGATGG + Intronic
1098909594 12:76195445-76195467 GGTGAACACATCCATGTGCCAGG - Intergenic
1100377291 12:94029165-94029187 GCTGGACACAACTAAGGGACTGG + Intergenic
1101955284 12:109207250-109207272 CATAAACACAACCGAGGGGCTGG - Intronic
1104943695 12:132406343-132406365 CGTGAACAGGACCATGGGGCAGG + Intergenic
1105247476 13:18666280-18666302 GGTCAACACCACCGAGGAGCTGG + Intergenic
1105642722 13:22282321-22282343 AGTGAAAACAAGCAAGGTGCAGG + Intergenic
1106090422 13:26587686-26587708 GGAGAAGACAATCAAGGGGGTGG + Intronic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1113078977 13:106496603-106496625 GGTGAACACCAGCAAGTGGCTGG - Intronic
1114399874 14:22400133-22400155 GGTGAGCACTGCCCAGGGGCAGG + Intergenic
1114717608 14:24844152-24844174 GGTGAACACACCCATGGGCAGGG + Intronic
1117932266 14:60855596-60855618 GGTGAACAGAAGCAAGGGTGGGG - Intronic
1118737501 14:68712473-68712495 GCTTAACACAACCAAAGGGGTGG - Intronic
1119751988 14:77085278-77085300 GGAGAAAACGATCAAGGGGCAGG + Intergenic
1121515605 14:94547913-94547935 GGTGATTGCAACCCAGGGGCAGG + Intergenic
1122362780 14:101177213-101177235 AGTAAACACAAATAAGGGGCAGG - Intergenic
1127860210 15:62987899-62987921 GGTCAACAGAACCAACAGGCGGG - Intergenic
1133083342 16:3341746-3341768 GGTGAACACATCCATGTGCCAGG - Intergenic
1136748337 16:32612010-32612032 GGTGAACTCAGCCAAGGGAGAGG + Intergenic
1137785809 16:51137005-51137027 GGGGAACAGAAGGAAGGGGCGGG + Exonic
1139583049 16:67884597-67884619 GGCCAACCCAGCCAAGGGGCCGG + Intergenic
1141818062 16:86426279-86426301 GGTGGACACATCCCAGGGGGAGG - Intergenic
1203050472 16_KI270728v1_random:871215-871237 GGTGAACTCAGCCAAGGGAGAGG + Intergenic
1145876829 17:28325249-28325271 GGGTAACACAAAGAAGGGGCTGG + Intronic
1146535561 17:33647596-33647618 GGTGAACACACACAAGCAGCAGG - Intronic
1146785021 17:35712245-35712267 GGTGAATATAACCAGGGGCCTGG - Intronic
1149444864 17:56705576-56705598 TGTTAACACATCCAAGGGGAGGG + Intergenic
1151370626 17:73644498-73644520 GGAGAACCCAACCAGGGGGCGGG - Intergenic
1152398386 17:80049077-80049099 GATGATCACAACCAAGGCGGGGG - Intronic
1152608309 17:81303771-81303793 GGGGAACAAGAACAAGGGGCTGG + Intergenic
1152772631 17:82179609-82179631 GGTGGACCCAGCCACGGGGCGGG + Intronic
1154377297 18:13820998-13821020 GCTCAACACCACCAAGGGGCTGG - Intergenic
1154441365 18:14392841-14392863 GGTCAACACCACCGAGGAGCTGG - Intergenic
1157292921 18:46422761-46422783 TGTGAACACCAGCAAAGGGCGGG - Intronic
1157680317 18:49600372-49600394 AGTGAACAGAACCAAGGGGTGGG + Intergenic
1161531576 19:4792913-4792935 GGTCAACACCACCGAGGAGCTGG + Exonic
1161566642 19:5006236-5006258 GGTGCACACTACCCAGAGGCAGG - Intronic
1163136725 19:15316819-15316841 GGTGAGCACCTCCAAGGGACAGG + Intronic
1163821059 19:19496771-19496793 GAAGAGCAGAACCAAGGGGCGGG + Intronic
1167444084 19:49527256-49527278 GGAGAGCAGAATCAAGGGGCCGG - Intergenic
929428195 2:41865085-41865107 GCTGCCCACAACCCAGGGGCTGG + Intergenic
931708445 2:64967436-64967458 GGGGAACAAAACCAAGTGGCTGG - Intergenic
934476310 2:94595849-94595871 GTTAAACACAGGCAAGGGGCTGG + Intronic
936236484 2:110746819-110746841 GGTGAAGGCAACTAAAGGGCGGG - Intronic
937738751 2:125322764-125322786 GGTGAGCAGGAACAAGGGGCTGG - Intergenic
938381007 2:130836755-130836777 GGTGACCAAAGCCCAGGGGCGGG + Intergenic
940848879 2:158669886-158669908 GGTGAACATAACCAAAGGCAGGG + Exonic
941572567 2:167190141-167190163 GGTGAACACATCCAAGTGCTGGG - Intronic
944605182 2:201346318-201346340 CGTGAGCAGATCCAAGGGGCAGG - Intronic
944605290 2:201346923-201346945 GGTGAACACAAGTCGGGGGCAGG - Intronic
946366575 2:219252757-219252779 GGTGAAGACACCCAGGGTGCGGG - Intronic
948875832 2:240827445-240827467 GGTGAACACACCCACGTGTCAGG + Intergenic
1171201477 20:23245371-23245393 GGTGCACACAAGCAACAGGCCGG + Intergenic
1171309224 20:24132841-24132863 GGTGAACACCAGCAAATGGCTGG + Intergenic
1172462840 20:35133141-35133163 AGTGATCCCACCCAAGGGGCAGG + Intronic
1173020476 20:39263692-39263714 GGAGAACAGCACCAAGGGGATGG + Intergenic
1173774732 20:45694923-45694945 GGTGAACACATCCATGTGCCAGG + Intronic
1174407555 20:50312034-50312056 GGTCAACAAACCCAAGGGGTAGG - Intergenic
1175567195 20:59989564-59989586 CGTGAACACGTCCAAGGAGCTGG - Intronic
1175626142 20:60489597-60489619 GGTGAACACACCTAAAGGGCTGG + Intergenic
1176382549 21:6120545-6120567 ACTGAACAAAATCAAGGGGCTGG + Exonic
1176454694 21:6898333-6898355 GGTCAACACCACCGAGGAGCTGG + Intergenic
1176832867 21:13763381-13763403 GGTCAACACCACCGAGGAGCTGG + Intergenic
1178320975 21:31605434-31605456 GGAGAACAGCACCAAGGGGATGG - Intergenic
1178813818 21:35908773-35908795 GGTGAAGGCAACTAAGGGACGGG + Intronic
1179740922 21:43417694-43417716 ACTGAACAAAATCAAGGGGCTGG - Exonic
1181432042 22:22887750-22887772 GGTGTGCACCACCCAGGGGCGGG + Intronic
1181613833 22:24038059-24038081 GGTGAACAACATCAAGGTGCTGG - Intronic
1183935162 22:41257819-41257841 GGGGCACACACCCAGGGGGCAGG + Intronic
1184170662 22:42757679-42757701 TGTAAACATAAACAAGGGGCAGG - Intergenic
1184441553 22:44519724-44519746 GGTGAACACATCCAGGTGCCGGG - Intergenic
950158946 3:10744276-10744298 GGGGAACACCCCCATGGGGCTGG - Intergenic
950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG + Intergenic
955840848 3:63111127-63111149 GGTTGCCACAACTAAGGGGCTGG - Intergenic
956465344 3:69515214-69515236 CGAGAACAGGACCAAGGGGCTGG + Intronic
957429587 3:80084886-80084908 GGTGGACACAAACATGGGGCAGG - Intergenic
961227383 3:125264026-125264048 GGTGAACACATCCAAGTGCCAGG + Intronic
964176737 3:153832617-153832639 GGAGAACAGCACCAAGGGGATGG + Intergenic
966741581 3:183239422-183239444 TGACACCACAACCAAGGGGCAGG + Intronic
968515361 4:1013354-1013376 GGTCAACACGCCCAAAGGGCCGG - Intronic
969739674 4:9015306-9015328 GGTGAAGACACCTAATGGGCAGG + Intergenic
969875643 4:10133833-10133855 GGGGGATACCACCAAGGGGCAGG + Intergenic
977352919 4:95910993-95911015 GGTGAAGACAACCAGGTGGGAGG - Intergenic
977400528 4:96525593-96525615 GGTGAACAGATCCAAGTGACAGG - Intergenic
979108908 4:116724905-116724927 GGGGAACACAAGAAAGGTGCTGG + Intergenic
979390067 4:120117706-120117728 TGTGAACACAGCCAAGAGGAAGG - Intergenic
981386074 4:144132156-144132178 GGTATACAAAACCAGGGGGCCGG + Intronic
982915359 4:161202508-161202530 GGTGAACTCAAACATGGGGTAGG - Intergenic
983449024 4:167887977-167887999 GGTGAGCCCAACAAAGAGGCTGG + Intergenic
986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG + Intronic
991395613 5:66202195-66202217 GGAGAAACCAACCAAGGGCCAGG - Intergenic
992771789 5:80055376-80055398 GCTGAGCACTACCATGGGGCTGG - Intronic
994812154 5:104533609-104533631 GGTGAACCAAACTAAAGGGCAGG + Intergenic
996078467 5:119226939-119226961 GGTGAACACATCCATGTGCCAGG - Intronic
997032303 5:130145070-130145092 TGAGAACAGCACCAAGGGGCTGG + Intronic
998442461 5:142173921-142173943 GGAGAACAGCACCAAGGGGATGG + Intergenic
999168709 5:149574489-149574511 GGTGAACACAACCAAGGGGCAGG - Intronic
1001335288 5:170791491-170791513 AGTGAACACTACCCAGGAGCTGG + Intronic
1002154564 5:177266256-177266278 GGTGACCATCACCAAGGGGAAGG - Intronic
1003860975 6:10321521-10321543 AGTGCACACAAACACGGGGCAGG + Intergenic
1004165740 6:13255248-13255270 GGAGAACAACACCAAGGGGAAGG + Intronic
1005982635 6:30848101-30848123 GGTGAACACATCCATGTGCCAGG - Intergenic
1011208198 6:84924318-84924340 GGTGATCACAAACTGGGGGCAGG - Intergenic
1012230724 6:96758270-96758292 GGAGAACAGCACCAAGGGGATGG - Intergenic
1015692753 6:135943932-135943954 GAAGAACTCATCCAAGGGGCTGG - Intronic
1018230631 6:161671822-161671844 GGACAAGACAACCAAGGGACTGG - Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1023642251 7:42271657-42271679 GGTGCACAGGACCAAGGGTCTGG - Intergenic
1023916492 7:44593510-44593532 GGTGAACACAACAGACAGGCGGG - Intergenic
1024445263 7:49470424-49470446 GGTGAACACATCCATGCGGTGGG + Intergenic
1025830245 7:65042830-65042852 AGTGTACCAAACCAAGGGGCAGG - Intergenic
1027199167 7:76052076-76052098 GGTGAACACAACATGGGGGAGGG - Intronic
1029380408 7:100210678-100210700 GGTGAACACAAACATGAGGGAGG - Intronic
1030633381 7:111919941-111919963 CATGACCACAACCAAGAGGCTGG + Intronic
1035731834 8:1859053-1859075 CGTGCAAACAACCAAGAGGCAGG - Intronic
1036490544 8:9221225-9221247 GGTGAACACATCCATGTGCCGGG + Intergenic
1038267300 8:26046993-26047015 AGTCAACACAACCCAGAGGCGGG - Intergenic
1052853727 9:33394073-33394095 GTTAAACACATGCAAGGGGCTGG - Intronic
1053424222 9:38000503-38000525 GGTGAGCAGAGCCAGGGGGCGGG + Intronic
1053931747 9:43118556-43118578 GTTAAACACAGGCAAGGGGCTGG - Intergenic
1054294846 9:63325744-63325766 GTTAAACACAGGCAAGGGGCTGG - Intergenic
1054392866 9:64630231-64630253 GTTAAACACAGGCAAGGGGCTGG - Intergenic
1054427516 9:65135440-65135462 GTTAAACACAGGCAAGGGGCTGG - Intergenic
1055794436 9:79959656-79959678 GGGGGACAGAAACAAGGGGCAGG + Intergenic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1062199718 9:135295808-135295830 GGTGAGAACAACTAAGGGGTTGG - Intergenic
1062428503 9:136516889-136516911 TCTGAACACAACCAATGGCCAGG + Intronic
1186379988 X:9047723-9047745 TGTGAAAACAAGCAAGGAGCAGG - Intronic
1187998612 X:24956576-24956598 ATTGAAAACAACAAAGGGGCGGG - Intronic
1188979631 X:36715282-36715304 GGTGCAAACAACCGAGGGGCTGG + Intergenic
1189182647 X:39018320-39018342 GGGGCACACAACCAGGGGACTGG - Intergenic
1189766045 X:44373078-44373100 GGTGCACACTACCAAGTAGCTGG - Intergenic
1195100628 X:101551380-101551402 GGGGAACACTACCAAGCGACAGG + Intronic
1197656274 X:129119528-129119550 GCAGAACAGAACCAAGGGACTGG - Intergenic
1199426123 X:147703013-147703035 GGTGATCTGAACCAAGGAGCAGG - Intergenic
1199879086 X:151958720-151958742 GGTGCAGAAAACCAAGAGGCAGG + Intronic