ID: 999169523

View in Genome Browser
Species Human (GRCh38)
Location 5:149581572-149581594
Sequence CGCACGGAGGTCGGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999169523_999169528 -9 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169528 5:149581586-149581608 CTCCGTGCGTGAGCGCCGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 67
999169523_999169534 20 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169534 5:149581615-149581637 GCGCGCGCGGGTGAGTCCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 103
999169523_999169532 8 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169532 5:149581603-149581625 GGCAGGCACCTTGCGCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 56
999169523_999169535 21 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169535 5:149581616-149581638 CGCGCGCGGGTGAGTCCGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 38
999169523_999169536 28 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169536 5:149581623-149581645 GGGTGAGTCCGCTGGGCGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 62
999169523_999169538 30 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169538 5:149581625-149581647 GTGAGTCCGCTGGGCGTTTGGGG 0: 1
1: 0
2: 0
3: 1
4: 49
999169523_999169531 7 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169531 5:149581602-149581624 CGGCAGGCACCTTGCGCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 43
999169523_999169537 29 Left 999169523 5:149581572-149581594 CCCGGGCGGCCGACCTCCGTGCG 0: 1
1: 0
2: 0
3: 9
4: 61
Right 999169537 5:149581624-149581646 GGTGAGTCCGCTGGGCGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999169523 Original CRISPR CGCACGGAGGTCGGCCGCCC GGG (reversed) Exonic