ID: 999171649

View in Genome Browser
Species Human (GRCh38)
Location 5:149600434-149600456
Sequence GGGCCAGAGAATGCATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999171643_999171649 16 Left 999171643 5:149600395-149600417 CCTGCATCTTTTTAAACAGTGGT 0: 1
1: 0
2: 2
3: 19
4: 216
Right 999171649 5:149600434-149600456 GGGCCAGAGAATGCATCTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999171649 Original CRISPR GGGCCAGAGAATGCATCTTG AGG Intronic
901674847 1:10877142-10877164 TGGCCAGTGAAGGCTTCTTGAGG + Intergenic
901865869 1:12106373-12106395 AGGCCAGGGAAGGCCTCTTGAGG - Intronic
903033446 1:20479489-20479511 GGGTCAGTGGAGGCATCTTGGGG - Intergenic
903477929 1:23633130-23633152 TGACCAGAGAAAGCATCTTTGGG + Intronic
903545938 1:24123438-24123460 GGGCCAGAGAAGGAAGCGTGAGG + Intronic
905682581 1:39884687-39884709 TGGCCAAAGAATGCAACATGTGG + Intergenic
906344188 1:45004990-45005012 AGGCCAGAGGAGGCATCCTGTGG + Intronic
906730679 1:48078253-48078275 GGGCCAGAGAAAGTGCCTTGGGG + Intergenic
907574816 1:55516785-55516807 GGGCCAGTGAATCCAGCTTCGGG + Intergenic
910689211 1:89948809-89948831 AGGCCAGAGAAAGCCTCTTTGGG - Intergenic
911722387 1:101205616-101205638 GGGAGAGAGAATGAATCTGGGGG - Intergenic
913963832 1:143358568-143358590 TGGCCCCAGAATGGATCTTGAGG - Intergenic
914058194 1:144184172-144184194 TGGCCCCAGAATGGATCTTGAGG - Intergenic
914120952 1:144782199-144782221 TGGCCCCAGAATGGATCTTGAGG + Intergenic
915111297 1:153566020-153566042 GGGCCAGAGGAGGCAGCTGGGGG + Intronic
915581766 1:156817000-156817022 GGGGCAGAGAAAGAATCTGGAGG - Intronic
915844204 1:159246821-159246843 TGGCCAGAGAATACACCTTGTGG - Intergenic
916669400 1:167000074-167000096 GGGCTACAGAATGAATATTGTGG - Intronic
919887114 1:201942579-201942601 TAGCCAGAGTATGCATCTTGGGG + Intronic
920416376 1:205801422-205801444 GGGCCAGGGATTGCAATTTGAGG - Intronic
921798726 1:219377886-219377908 GGGCCAGAGAGTAAATATTGTGG + Intergenic
922131710 1:222786826-222786848 TGCTCAGAGAATGCATCATGGGG - Intergenic
923997552 1:239512442-239512464 GGGTCAGAGAAAGGATCTGGAGG - Intronic
924828017 1:247562350-247562372 GTGCCAGAGGATGCATGTGGTGG + Intronic
1067174110 10:43930492-43930514 GGTCCAGAGACTGCATCCTGGGG + Intergenic
1067661650 10:48240611-48240633 GTGCCAGAGAACACATCTTTAGG - Intronic
1068145886 10:53070096-53070118 GGGCTGGAGAATGCATGTTGAGG + Intergenic
1069181777 10:65369982-65370004 GGGGTAAAGAATGGATCTTGAGG + Intergenic
1070769082 10:79071783-79071805 GGCCCAGGGAATGCATTTGGAGG + Intronic
1073989505 10:109246334-109246356 AGGCCACAGCATGCTTCTTGTGG + Intergenic
1075511112 10:123073664-123073686 GAGCCAGAGAATGCAGCTAAGGG - Intergenic
1076109749 10:127851409-127851431 GGCCCAGAGGATGCTTCATGGGG + Intergenic
1077541389 11:3148111-3148133 GTGCCAGTGAATGCCTCCTGGGG + Intronic
1078142017 11:8699735-8699757 GGGCCAGTGAATGCAGATCGTGG + Intronic
1078188094 11:9069303-9069325 GGGCCACAGAAGGCAGCCTGTGG + Intronic
1078715306 11:13834031-13834053 AGGCCTGAGAAAGCATCCTGGGG - Intergenic
1084850720 11:71937749-71937771 CTGCCAGAGAATGCCTCTGGGGG + Intronic
1084875858 11:72132727-72132749 GGGCCAGAGAAAGGACATTGGGG + Intronic
1086664054 11:89457531-89457553 GGGCCAGAGACTGCAGCTGAGGG + Intronic
1089101471 11:115966140-115966162 GGTCCAGATAATGCATCGAGGGG - Intergenic
1090279608 11:125444644-125444666 AGGCCACAGAATCCATCTAGGGG - Intergenic
1091975367 12:4820378-4820400 GGGGCAGTGAATGCCTCTTTAGG + Intronic
1094855430 12:34400792-34400814 GGCCCAGAAAATGCATGGTGGGG - Intergenic
1095631131 12:44378804-44378826 GGGCCAGAGAATCGAACTTTGGG + Intronic
1096498113 12:52050374-52050396 GGGCCACAGACTGCATCTCTAGG - Intronic
1096670460 12:53195547-53195569 GGGACGGAGAATGTATCTTTGGG + Intronic
1098295585 12:69000999-69001021 GGGGCAGAGAATGACTCTGGAGG + Intergenic
1103584892 12:121945219-121945241 GGGCCAGATAATGCAGGTAGAGG - Intronic
1103632354 12:122272023-122272045 AGGCCAGACATAGCATCTTGTGG - Exonic
1103889069 12:124224937-124224959 GGGGCAGAGAAAGCAGCCTGTGG - Intronic
1104994125 12:132643428-132643450 GGGCCAGAGAGCGCATCTCCAGG + Exonic
1105978938 13:25499083-25499105 AGGATAGAGAATGGATCTTGGGG - Intronic
1111592717 13:90370691-90370713 TGGACAGAGGATGCATCCTGTGG + Intergenic
1111971322 13:94919909-94919931 GGGCCAGAGAATTCAGAGTGAGG - Intergenic
1114976350 14:28105496-28105518 GGGCCAGAAGATGGATCTGGAGG + Intergenic
1115726835 14:36226531-36226553 TGGCCAGAGAAAGAGTCTTGTGG - Intergenic
1118089501 14:62457524-62457546 GGGCAAGAGAAGGGATTTTGTGG - Intergenic
1118348873 14:64959448-64959470 GGGGCAGAGAATACATTTTGTGG + Intronic
1120182089 14:81354133-81354155 TGGCCAGGGAATGCACCCTGTGG + Intronic
1120939180 14:89930361-89930383 GGGGGAGAGAATGGATATTGGGG - Intronic
1121078361 14:91087992-91088014 AGGTCAGAGGAGGCATCTTGGGG + Intronic
1121122998 14:91387988-91388010 GGTCCAGACAATGCATTTTAAGG + Intronic
1122858412 14:104571202-104571224 GGGCCACACAAAGCCTCTTGGGG + Intronic
1124628213 15:31322313-31322335 GGCCCAGACAATTCATCTTTAGG + Intergenic
1124860059 15:33430602-33430624 GGGCCAGAGAATCCATTTGGTGG + Intronic
1125108440 15:36002426-36002448 TAGCCAGAAAATGCTTCTTGGGG - Intergenic
1127079915 15:55367440-55367462 AGGCCAAAGATTGTATCTTGAGG - Intronic
1129800277 15:78408676-78408698 GGGACAAAGAAAGCCTCTTGAGG + Intergenic
1130690067 15:86074520-86074542 GGGGCAGAGAAAGCATCTCCAGG - Intergenic
1134418214 16:14062711-14062733 GGGCCAGAGAAAAGAACTTGAGG + Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1137620844 16:49875935-49875957 GGGCCTGAGAAAGCCTTTTGTGG + Intergenic
1137723651 16:50642415-50642437 GGACCACAGAATGCAGCCTGGGG + Intergenic
1138025539 16:53519570-53519592 GAGTCAGAGAAGGCTTCTTGGGG - Intergenic
1139106831 16:63836021-63836043 GGGCCAGAGAATGAATCTGTGGG + Intergenic
1141746689 16:85930928-85930950 GGGCCAGAGGAGGCAGCGTGTGG + Intergenic
1142317672 16:89358689-89358711 GGGCCAGCGAGGGCAGCTTGTGG - Intronic
1144711477 17:17404254-17404276 GGGACAGAGCCTGCATCTGGGGG - Intergenic
1148195570 17:45710346-45710368 GGCACAGAGACTGCAACTTGGGG + Intergenic
1149911003 17:60566695-60566717 GGGCTAGAGAATCCACCTTCAGG - Intronic
1150584060 17:66501649-66501671 TGGCCCTAGAATGCAGCTTGGGG + Intronic
1151983712 17:77528862-77528884 GCGCCAGACGATGCATCTTCTGG + Intergenic
1153263204 18:3244146-3244168 GGGACAGATACTGCATCTAGTGG - Intergenic
1154472473 18:14718167-14718189 AGGACAGAGGATGCATATTGGGG + Intergenic
1157159720 18:45302482-45302504 GGCCCAGACAAGGAATCTTGAGG - Intronic
1157775404 18:50391542-50391564 GAGCCAGAGAATTTATTTTGTGG - Intronic
1158203661 18:54966940-54966962 AGGCCAAAGAATTCAACTTGGGG + Intergenic
1158697989 18:59719610-59719632 TGGCCAAAGCATGCATTTTGAGG - Intergenic
1159799426 18:72879098-72879120 GAACCTGAGAATGGATCTTGTGG + Intergenic
1159905972 18:74092804-74092826 GTGCCAGATAAAGCATCATGTGG + Intronic
1161062942 19:2224115-2224137 GGGACCGAGGATGCACCTTGAGG - Intronic
1162843975 19:13377661-13377683 GGGCTACAGAATGAATGTTGTGG - Intronic
1163719765 19:18893615-18893637 GGGCCAGAGACTGCTCCTTTGGG + Intronic
1167377898 19:49121233-49121255 AGGCCACAGAATACATCTGGAGG - Intronic
1202697677 1_KI270712v1_random:136829-136851 TGGCCCCAGAATGGATCTTGAGG - Intergenic
927680052 2:25133053-25133075 GGGTCAGAAAATGCAGCTGGGGG - Intronic
927973585 2:27321364-27321386 GGGCCAAAGAATCCATCTCCTGG + Intronic
929248586 2:39729115-39729137 GGGCCAGAAAATTAATCTAGGGG + Intergenic
931098639 2:58970822-58970844 GGGCCAGAGAAGGCCTCTTGTGG - Intergenic
931701312 2:64911301-64911323 GGGCCAGAGTATGACTTTTGTGG + Intergenic
932778667 2:74545771-74545793 GGCCCAGAGACTGAACCTTGGGG - Intronic
934278850 2:91593825-91593847 TGGCCCCAGAATGGATCTTGAGG - Intergenic
934897891 2:98134328-98134350 GGGCCTGCGGATGCAGCTTGAGG + Intronic
936440902 2:112552090-112552112 GGGAATGAGAATGAATCTTGGGG + Intronic
936584125 2:113737762-113737784 GAGCCAGAGAATGGAGTTTGGGG - Intronic
936619969 2:114085283-114085305 CGGCCAGAGAATCCATATTGGGG + Intergenic
936854910 2:116945700-116945722 GAAGCAGATAATGCATCTTGAGG + Intergenic
937070148 2:119057041-119057063 GGGCCACACAATGCTTTTTGGGG + Intergenic
937345587 2:121123452-121123474 GGGCCACAGCCTGCATCTGGGGG + Intergenic
938938996 2:136152767-136152789 GTGCCAGAGAATGCTTGGTGAGG + Intergenic
939185850 2:138860117-138860139 GGGCTACAGAATGCATATTGTGG + Intergenic
939257544 2:139763994-139764016 GTTCCAGAGACTGAATCTTGAGG - Intergenic
939406142 2:141759450-141759472 GGGATAGGGAATGCAACTTGTGG + Intronic
944511774 2:200472489-200472511 GGGCCAGAGAGGGAACCTTGAGG + Intronic
947025607 2:225734591-225734613 GAGCCAGAGAAGGACTCTTGGGG + Intergenic
947659098 2:231853413-231853435 GGGCCTGAGAATGCAGCCTCGGG + Intergenic
947778663 2:232737131-232737153 GGGCCAGAGAATTAATGTTTAGG - Intronic
948152113 2:235752592-235752614 GGGCCAGAGAGTGAATATTCTGG - Intronic
948809881 2:240469025-240469047 GGGCCAGGGGATGCAGCCTGGGG + Intergenic
1169550543 20:6697418-6697440 AGGGCAGAGGATGCATCTGGGGG - Intergenic
1170710870 20:18789593-18789615 GGTCCAGAGAAAGCAGCTTGGGG + Intergenic
1174496504 20:50948005-50948027 GGGCCAGAGAATGGGTCTGAGGG - Intronic
1174552661 20:51373015-51373037 GGGCCACAGAATCCCTGTTGGGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1176802019 21:13439726-13439748 AGGACAGAGGATGCATATTGGGG - Intergenic
1179511484 21:41876917-41876939 GGGGCAGAGTCTGCATCTTTTGG - Intronic
1182154058 22:28052404-28052426 GGGCAAGTGACTGAATCTTGCGG - Intronic
1183064595 22:35354291-35354313 GGGCCTGAGAAGGGATCCTGAGG - Intergenic
1184689169 22:46109709-46109731 GGGCCAGAGAGTGAGTCTTCAGG - Intronic
1185158506 22:49208442-49208464 GGGACAGAGAATGCAGCCTAGGG - Intergenic
950652077 3:14413498-14413520 GGGCCAGGGACAGCATTTTGAGG - Intronic
950861087 3:16148248-16148270 GGGGCATAGAATGCATCAGGAGG - Intergenic
955579246 3:60401310-60401332 AGGAAAGAGAATGCATCTGGTGG - Intronic
956876995 3:73473783-73473805 GGGCCAGAGGATCCACCTCGAGG - Intronic
958423896 3:93959432-93959454 TGGCAAGAGAATGCAGCTTGTGG - Intronic
959976291 3:112463642-112463664 GCGCCAGAGAATTCATTCTGGGG + Intergenic
961841299 3:129715259-129715281 TGGCCAGAGAGTGCATTTTAAGG - Intronic
963298632 3:143574855-143574877 TGGGCAGAGAATGGATCATGCGG + Intronic
964869988 3:161302990-161303012 GGGCCTGAGAATGTATGTTAGGG + Intergenic
965508220 3:169539677-169539699 TGGGCAGAGCATGGATCTTGAGG - Intronic
966568864 3:181417582-181417604 AGGCCACAAAATGCATCTTCTGG + Intergenic
967661391 3:192114688-192114710 GGGCTATAGAATGGATGTTGTGG + Intergenic
968617907 4:1588621-1588643 GGGCTGGAGAATTCGTCTTGAGG - Intergenic
969031945 4:4222664-4222686 TGGCCCCAGAATGGATCTTGGGG + Intronic
969837181 4:9851239-9851261 GGGCCAGAGAACAAATCTAGGGG + Intronic
971644103 4:29174162-29174184 GGGCTACAGAATGGATGTTGTGG - Intergenic
972316999 4:37935989-37936011 GGGCCAGAGAAGGCCTCCTGGGG - Intronic
981947162 4:150361639-150361661 GGGCCTGGGACTGAATCTTGAGG - Intronic
982283079 4:153705935-153705957 AGGACAGAGAATGCCTTTTGTGG - Intergenic
982322149 4:154088291-154088313 GGGCCAGACAATTCTTTTTGTGG - Intergenic
987325156 5:16805793-16805815 GGGCAAGGGAATGTATTTTGGGG - Intronic
988297630 5:29386867-29386889 GGGTCACAAAATGCATATTGAGG + Intergenic
989210671 5:38855923-38855945 GAGCCAGAGAAGACATCTAGAGG - Intronic
989491579 5:42061470-42061492 GAGCCACAGAAGGCATGTTGAGG + Intergenic
990848557 5:60174244-60174266 GGGCCAATGACTGAATCTTGGGG + Intronic
991060872 5:62374387-62374409 GGGCCAGATAATACATGTTTTGG - Intronic
991449045 5:66732306-66732328 GGGCCAGAAAATGAGGCTTGGGG - Intronic
993502874 5:88681626-88681648 GGGAAAAAGAAGGCATCTTGGGG - Intergenic
993987998 5:94619670-94619692 GTGACAGACAATGCACCTTGTGG + Intronic
997264266 5:132486008-132486030 GGGCCAGGGGCTGCATTTTGGGG - Intronic
997295088 5:132764111-132764133 GGGCCAGGGAGGGCCTCTTGGGG - Intronic
998562470 5:143184242-143184264 GGGGTAGAGAATGCCTCTTTTGG + Intronic
999171649 5:149600434-149600456 GGGCCAGAGAATGCATCTTGAGG + Intronic
1001184193 5:169551986-169552008 GACCCAGAGAATGCATTTTTAGG + Intergenic
1006831049 6:36968593-36968615 GGGCCAGAGAATGGCTTATGGGG - Exonic
1011551409 6:88534195-88534217 GGGCCAGAGAAGGATTCTAGAGG - Intergenic
1011715954 6:90105170-90105192 GGGTCAGTGAATGCAACATGGGG - Intronic
1012975053 6:105771678-105771700 GGGCCATAGAATGCTGCATGTGG + Intergenic
1016606858 6:145939017-145939039 GGGCCAGATAATTCTTCTTTGGG - Intronic
1017770481 6:157640338-157640360 TGTCCAGTGAATGCAACTTGGGG - Intronic
1018168875 6:161128032-161128054 GGGCCAGAGAGTGAATATTTTGG + Intergenic
1019998186 7:4738650-4738672 GGCCCAGCGAGTGAATCTTGGGG - Intronic
1022475385 7:30706488-30706510 GGGCCAGGGAAGGCAGCTTAAGG + Intronic
1026772705 7:73212412-73212434 GGGCCAGAAAAAGAAACTTGGGG - Intergenic
1027013569 7:74765812-74765834 GGGCCAGAAAAAGAAACTTGGGG - Intergenic
1027074469 7:75180221-75180243 GGGCCAGAAAAAGAAACTTGGGG + Intergenic
1029728468 7:102424261-102424283 GGGCCAGCCAATGCTCCTTGAGG - Intronic
1029883286 7:103839237-103839259 GGTCCAGAGAATACATGTTTGGG - Intronic
1030442430 7:109604106-109604128 GGGCAAGTGAATGCATGTTCAGG - Intergenic
1032865752 7:135922334-135922356 GGGCCAGATAATAAATATTGTGG + Intergenic
1037856425 8:22374445-22374467 GTGACAGAGAAGGCTTCTTGGGG + Intronic
1040046189 8:42966324-42966346 GTGCTTGAGAATGCAGCTTGTGG + Intronic
1041468321 8:58180345-58180367 GTGCTAGAGGATGCATCGTGTGG + Intronic
1045209332 8:100079739-100079761 GAGCCACACAATGCAACTTGAGG + Intronic
1046114201 8:109765653-109765675 GGCCCAGACAGTGCAGCTTGTGG - Intergenic
1046581838 8:116102775-116102797 GGGCCACAGAATGAACCATGGGG - Intergenic
1048647216 8:136435477-136435499 TTGCCACAAAATGCATCTTGTGG - Intergenic
1049782788 8:144436423-144436445 GGGAGAGAGAATGCGTGTTGAGG + Intronic
1050305277 9:4299806-4299828 GGGCCGGGGAATGCTTCTGGGGG + Exonic
1050490567 9:6184254-6184276 AGGGCAGAGAATGGATCTGGAGG - Intergenic
1051809711 9:21034597-21034619 TGGCCAGAGAATGCCTGGTGTGG - Intergenic
1055183644 9:73422719-73422741 AGGCCAGAGAACTCACCTTGAGG - Intergenic
1057202849 9:93152117-93152139 TGGCCAGAGAATTCATCCTTGGG + Intergenic
1058638717 9:107062148-107062170 GGGCTAAAGAATGGATATTGTGG + Intergenic
1058895534 9:109397590-109397612 GGGCAAGAGAAACCATCTAGCGG + Intronic
1059031493 9:110702423-110702445 GGGCCAGAAATTCCATCTTCAGG + Intronic
1059737716 9:117118859-117118881 TGGTCAGAGAAGGCTTCTTGAGG - Intronic
1061611597 9:131750206-131750228 GTGACAGAGAGTCCATCTTGGGG + Intergenic
1062383901 9:136300938-136300960 AGGCCTGAGAATGCATCCAGTGG + Intronic
1189744625 X:44157390-44157412 AGGGCAAAGAATGGATCTTGAGG - Intronic
1189891687 X:45609893-45609915 GGGCCAGAGAATGAATCCGGGGG - Intergenic
1195268723 X:103210532-103210554 GGGACAGAGACTGCAACTTGTGG - Intergenic
1199177722 X:144811208-144811230 GTGCAAAAGAATACATCTTGTGG + Intergenic
1200213356 X:154356675-154356697 GGGCCACAGAATGCACTTTGGGG + Intronic