ID: 999173950

View in Genome Browser
Species Human (GRCh38)
Location 5:149618481-149618503
Sequence GAGGGGTTTCTCCAGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999173943_999173950 2 Left 999173943 5:149618456-149618478 CCCACTTGATTCTGAAGAGCCAG 0: 1
1: 0
2: 3
3: 16
4: 161
Right 999173950 5:149618481-149618503 GAGGGGTTTCTCCAGTGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 156
999173942_999173950 3 Left 999173942 5:149618455-149618477 CCCCACTTGATTCTGAAGAGCCA 0: 1
1: 0
2: 2
3: 17
4: 155
Right 999173950 5:149618481-149618503 GAGGGGTTTCTCCAGTGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 156
999173944_999173950 1 Left 999173944 5:149618457-149618479 CCACTTGATTCTGAAGAGCCAGT 0: 1
1: 0
2: 0
3: 15
4: 164
Right 999173950 5:149618481-149618503 GAGGGGTTTCTCCAGTGTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999173950 Original CRISPR GAGGGGTTTCTCCAGTGTCT TGG Intronic
903408829 1:23122644-23122666 GAGTAGTTTCTTCAGTGTCCTGG - Intronic
905313510 1:37066522-37066544 GAGCTGTGTCTTCAGTGTCTAGG + Intergenic
906352827 1:45078761-45078783 GGGGGGTTCCTCCAGACTCTGGG + Intronic
910460660 1:87444889-87444911 GAGGCATTTCCCCATTGTCTTGG + Intergenic
915401115 1:155622506-155622528 GAGGGGAGTCTTCAGTGTCATGG + Intergenic
915815647 1:158962410-158962432 GTGGGGTGGCTCCAGTGTGTTGG - Intronic
922483351 1:225954899-225954921 CAGAGGTTTCTCCAGGCTCTGGG - Intergenic
923345295 1:233045751-233045773 GAGGTGTTCATCCAGTTTCTGGG + Intronic
1065736436 10:28756909-28756931 GAGGGTTTTCTGCAGCCTCTGGG - Intergenic
1069532398 10:69229121-69229143 AAGGGGTTTCTCCCATGTCAGGG + Intronic
1076079542 10:127566275-127566297 GTGTGCTTTCTCCAATGTCTTGG + Intergenic
1076901220 10:133338954-133338976 GAGGTGTGTGTCCAGTGTTTGGG - Intronic
1078006401 11:7535752-7535774 GAGGAGGTTCTCCAGTGCCCTGG + Intronic
1080952858 11:37056329-37056351 GAGGGGTTTCTCCTTTCCCTTGG + Intergenic
1081608169 11:44540601-44540623 GAGGGGATTCACCACTTTCTTGG + Intergenic
1081907681 11:46679866-46679888 GAGGGGCTTATGCAGTGTCCAGG - Intronic
1083019926 11:59496377-59496399 AAGGGGTTTCTCCTTTTTCTTGG + Intergenic
1083535607 11:63464114-63464136 GAGGCTTTTCTCTAGTGTCCGGG - Intronic
1083682402 11:64357653-64357675 CAGGCCTTTCTCCAGGGTCTTGG + Intergenic
1086936160 11:92747517-92747539 GAGGCGTTTTCCCATTGTCTTGG + Intronic
1088143182 11:106643296-106643318 GAAGGGTTTCTCCAAACTCTTGG + Intergenic
1090537841 11:127664226-127664248 CAGGGGTTTCTCTAGTGGCATGG - Intergenic
1091805685 12:3354396-3354418 GAAGGGCTTCTCCATGGTCTTGG - Intergenic
1092062799 12:5564807-5564829 GATGGGCTTCTCCACTTTCTGGG + Intronic
1092076585 12:5678418-5678440 CAGGGGTATCTCCAGGCTCTGGG + Intronic
1094056973 12:26277890-26277912 CAGGGGCGTCCCCAGTGTCTTGG + Intronic
1094707191 12:32925641-32925663 CAGGGGTTTGCCCAGTCTCTAGG + Intergenic
1095719441 12:45385041-45385063 GTGGGGGTCCTCCAGTTTCTGGG + Intronic
1096857236 12:54492818-54492840 GAAGGGTTCCTCCAGTTTATGGG + Intergenic
1099360457 12:81694229-81694251 GAGGCCTTTTTCCATTGTCTTGG - Intronic
1103312073 12:120018405-120018427 GAAAGGTTCCTCCAGTGCCTTGG - Intronic
1104171968 12:126291074-126291096 AAGGGGTTTCCCCTGTCTCTTGG - Intergenic
1106500378 13:30322673-30322695 GAGGGGTTCCTGCAATGTGTGGG - Intergenic
1111505519 13:89184031-89184053 GAGGTATTTCCCCACTGTCTTGG + Intergenic
1114733639 14:25020916-25020938 TATGGCTTTCTCCAGTGTCCAGG - Intronic
1115024439 14:28725151-28725173 GAGGGGCTTCTCATGTGTATAGG - Intergenic
1115840347 14:37462432-37462454 GAGACATTTCTCCATTGTCTTGG + Intronic
1117400443 14:55354459-55354481 GAGTTGTTTATCCAGTGTCCAGG - Intronic
1117802299 14:59457313-59457335 TAGGAGTTTCTTCAGTTTCTTGG + Intronic
1121631879 14:95427201-95427223 TAGGGGTAACGCCAGTGTCTGGG + Intronic
1122384436 14:101334333-101334355 GAGGGGTCTCTGCAGTGTCCTGG - Intergenic
1125456794 15:39868224-39868246 AATGGGTTTCTCCAGGCTCTTGG + Intronic
1126053766 15:44711019-44711041 GCAGGGTTTCTCCATTCTCTGGG - Intronic
1128241572 15:66104961-66104983 GAGGGGTTTCTGCAGTACCCGGG - Intronic
1129738290 15:77977669-77977691 GATGAGTCTCTCCAGTCTCTGGG - Intergenic
1131123449 15:89837877-89837899 GAGGGGTCTCTCCCAGGTCTTGG + Intronic
1132394004 15:101459168-101459190 GAGGAGTTTCTCCCTTGTTTTGG - Intronic
1132985614 16:2765692-2765714 GAGGGACTTCTCCGGTGCCTTGG - Exonic
1136428565 16:30184477-30184499 GATGGTTTCCCCCAGTGTCTGGG - Intronic
1136748341 16:32612029-32612051 GAGGGGCTGCTCCAGAGTCCAGG + Intergenic
1140406279 16:74713627-74713649 GAGGGGCTGCCCCAGGGTCTGGG + Exonic
1203050476 16_KI270728v1_random:871234-871256 GAGGGGCTGCTCCAGAGTCCAGG + Intergenic
1145779627 17:27553665-27553687 AAGGGGTTTCTGGAGAGTCTGGG - Intronic
1148575739 17:48709717-48709739 CAAGGGTTTTTCCAGTGGCTGGG - Intergenic
1149326176 17:55531922-55531944 GAGGTATTTCTCCATTGTGTAGG + Intergenic
1155403716 18:25465352-25465374 CAGGGCTTTCTCCAGTGTCCTGG - Intergenic
1160097861 18:75891583-75891605 GAGGGGTTTTCCAAATGTCTGGG + Intergenic
1160129410 18:76211326-76211348 GAGGGGTGACTCAAGTGTCCTGG + Intergenic
1162953487 19:14085570-14085592 GCGGTGTTTCTCCAGGGTCCAGG + Exonic
1164124693 19:22302161-22302183 CAAGAGTTTCTCCAGTTTCTTGG + Intronic
1166921487 19:46231857-46231879 GAAAGCTTTCTCCAGAGTCTTGG + Intergenic
927424967 2:22971266-22971288 GAGGAGTTTGTCTTGTGTCTTGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928696376 2:33853720-33853742 GAGGCCTTTCTCCATTGTCTTGG + Intergenic
931379883 2:61742877-61742899 AAGGGCTTTTTCCAGGGTCTTGG + Intergenic
934620009 2:95798081-95798103 GAGGGATTTTTCCTGTGTCATGG + Intergenic
934640879 2:96026476-96026498 GAGGGATTTTTCCTGTGTCATGG - Intronic
939361207 2:141175309-141175331 GTGGGTTTTCTTCATTGTCTTGG - Intronic
940645018 2:156382291-156382313 TAGATGTTTCTCCATTGTCTTGG + Intergenic
940971626 2:159902903-159902925 GAGGGGCTCCTTCAGTGTTTGGG + Intronic
943788113 2:191901191-191901213 GAGGCATTTCCCCATTGTCTTGG - Intergenic
945168536 2:206971563-206971585 GAGGGGCTTCGCCTGTCTCTGGG + Intergenic
947148121 2:227087093-227087115 GAGGGCTCTCTCCAGTCTCCAGG + Intronic
947974333 2:234352082-234352104 AAGGGGTAACGCCAGTGTCTGGG + Intergenic
948874265 2:240818931-240818953 GAAGGGGTCCTCCAGTCTCTGGG + Intronic
1168760520 20:347182-347204 GCGGGGGTTCTCCAGGGGCTGGG - Intronic
1169596068 20:7200552-7200574 TAGGGGTTTTGCCAGTGTCCTGG - Intergenic
1169782918 20:9328494-9328516 GATGGGTTTCTGAAGTGTTTTGG - Intronic
1169947148 20:11001311-11001333 GAGGTGAATCTCTAGTGTCTGGG + Intergenic
1171342934 20:24444784-24444806 GAGGGGTCCCTGCTGTGTCTCGG + Intergenic
1173431579 20:42992272-42992294 GAGGGGTTTTTTCAATGTCCGGG - Intronic
1174196645 20:48776995-48777017 GAGGGGTTTCTCCCGCCCCTTGG + Intronic
1175378306 20:58544636-58544658 GAGGGATTTCTTTAGTCTCTGGG - Intergenic
1175871813 20:62212829-62212851 GAGGGGTCACTTGAGTGTCTGGG + Intergenic
1176103127 20:63373555-63373577 GACAGCTTCCTCCAGTGTCTCGG + Intronic
1176173145 20:63705359-63705381 GTGGGGTGTCCCCAGTGCCTTGG - Intronic
1178207432 21:30486295-30486317 GAGGCATTTTTCCATTGTCTTGG - Intronic
1178944941 21:36939281-36939303 ATGGTGTTTTTCCAGTGTCTGGG - Intronic
1179465345 21:41568045-41568067 GAGGGGCTTCGTGAGTGTCTGGG + Intergenic
1179618631 21:42598180-42598202 GTGGGGACTCTCCAGTGCCTGGG + Intergenic
1181500271 22:23312063-23312085 CAGGGGTTTCTGCAGGGCCTTGG + Intronic
1182249619 22:28989752-28989774 GAGGGGGTTAGCCTGTGTCTAGG - Intronic
1183120849 22:35728942-35728964 GAGGGGTTACTTCACTGTCAGGG - Intronic
1185204024 22:49526661-49526683 GCAGGGTGTCTCCAGTGTCAGGG - Intronic
953024684 3:39138052-39138074 AAGGGGTTACGCCAGTGTCTGGG + Intronic
954287797 3:49631082-49631104 TACCTGTTTCTCCAGTGTCTGGG - Intronic
955142878 3:56287036-56287058 GAGGGGTCTCTTAAGTGTTTCGG - Intronic
957750833 3:84413108-84413130 GAGGGGTCTCTCCACACTCTTGG + Intergenic
957945515 3:87057903-87057925 GAGAGATTTCCCCATTGTCTTGG + Intergenic
959390738 3:105770354-105770376 GAAGGGCTTCTCCAGTGGCCTGG - Intronic
959769160 3:110072130-110072152 GAGGCCTTTCCCCATTGTCTTGG - Intergenic
959830617 3:110857482-110857504 CAGGGGTCTCTCAAGTGGCTTGG - Intergenic
963914595 3:150846571-150846593 GAAGGGTTTCTCCAATTTCTTGG - Intergenic
964130095 3:153276888-153276910 GAGGGCCTTCTCCAGTATTTGGG - Intergenic
966047034 3:175564753-175564775 GTCTGGTTTATCCAGTGTCTTGG + Intronic
969020628 4:4137925-4137947 CAGGGGTTTTTCCACTCTCTCGG - Intergenic
972011072 4:34182871-34182893 AAGGGGTTTCTCCATTCACTTGG - Intergenic
975974244 4:80076793-80076815 GAGGGGTGTCTTCAGTCTCATGG + Intronic
983217626 4:165016860-165016882 CAGGGGTCTCTACAGTGTCCTGG + Intergenic
990131555 5:52592343-52592365 AAGGGCTTTTTCTAGTGTCTGGG - Intergenic
990206280 5:53433097-53433119 GAGGTGTTTCCACAGTCTCTTGG + Intergenic
991205759 5:64048676-64048698 GAAAGCTTTCTCCAGAGTCTTGG - Intergenic
992263312 5:74992301-74992323 GAGGAGTCTATCCAGAGTCTCGG - Intergenic
994210555 5:97083857-97083879 GAGGGGATTCTCCAGAACCTAGG - Intergenic
995608070 5:113879790-113879812 GAGACGTTTCTTCATTGTCTTGG - Intergenic
999173950 5:149618481-149618503 GAGGGGTTTCTCCAGTGTCTTGG + Intronic
999734200 5:154500393-154500415 GAGGTGTGTCTCCTGTGTTTTGG - Intergenic
1001936244 5:175707980-175708002 GAGCGGTATCTTCAGTGTCCTGG - Intergenic
1001990215 5:176110419-176110441 GAGGGGCTGCTCCAGAGTCCAGG + Intronic
1002166458 5:177350566-177350588 AAGGGGTTCCTCCACTGTCCAGG + Intronic
1002267186 5:178043492-178043514 GAGGGGCTGCTCCAGAGTCCAGG + Intronic
1003309506 6:4957266-4957288 GAGGGGTGCCCCCAGTCTCTGGG + Intergenic
1003971818 6:11307428-11307450 GTGTGGTTACCCCAGTGTCTTGG + Intronic
1006263671 6:32897209-32897231 GAGGCATTTCTCAGGTGTCTGGG - Intergenic
1008761918 6:54861964-54861986 GAAGGTTTTCTCTAGAGTCTTGG + Intronic
1011259028 6:85452886-85452908 GAGGGGCATCTCCAGTTTCCTGG + Intronic
1014450035 6:121571976-121571998 GAAATGTTTCTCCATTGTCTTGG - Intergenic
1014692578 6:124579188-124579210 GTGGATGTTCTCCAGTGTCTGGG - Intronic
1015755667 6:136603741-136603763 TCAGGTTTTCTCCAGTGTCTAGG - Intronic
1017182329 6:151565093-151565115 GTGGGGTTGCTGCAGTGGCTTGG + Intronic
1017392789 6:153959114-153959136 GAGGCTTTTTTCCATTGTCTTGG + Intergenic
1018902079 6:168056721-168056743 GAGCTGTCTCTCCAGGGTCTGGG + Exonic
1019810737 7:3163431-3163453 GAGGGGTTTCTCCGCTGACTGGG - Intronic
1021201115 7:17729466-17729488 GAGGGAAATCTCCAGTGTTTTGG - Intergenic
1023688649 7:42763508-42763530 GAGGGCTTTCTCCGGTGCCAGGG + Intergenic
1026032813 7:66809100-66809122 GAGGTCTTTTTCCAGTTTCTTGG - Exonic
1026236738 7:68533808-68533830 AAGGGGTTTCTCCTTTCTCTGGG + Intergenic
1026898843 7:74026277-74026299 GAAGGGTTTGTCCAGGGTCCTGG + Intergenic
1027869026 7:83682784-83682806 GAGGAGTGGCTACAGTGTCTGGG + Intergenic
1034499061 7:151438514-151438536 CAGGGGTTTCCCCTTTGTCTAGG + Intronic
1038085050 8:24186888-24186910 GAGGGCGTTCTCCCCTGTCTGGG + Intergenic
1038876782 8:31559014-31559036 AGGGGGTTTCTCCAAGGTCTGGG + Intergenic
1040863416 8:52023936-52023958 GAGAATTTTCTCCATTGTCTTGG - Intergenic
1044152628 8:88800589-88800611 GAGACATTTCTCCATTGTCTTGG - Intergenic
1046407348 8:113791187-113791209 GTGGGGTTTCACCAGGGGCTGGG + Intergenic
1047807833 8:128377967-128377989 GAGGGGAGTCTTCAGTGTCATGG + Intergenic
1048306051 8:133285554-133285576 GAGGTGTTTCACCAGGTTCTTGG - Intronic
1048916230 8:139186217-139186239 TAGGGGTTTATCCACTTTCTAGG - Intergenic
1048923904 8:139253773-139253795 GAGGGGTTCAACAAGTGTCTGGG - Intergenic
1051395699 9:16617854-16617876 GACAGGTTTCTGAAGTGTCTGGG - Intronic
1053872610 9:42508331-42508353 GAGGGATTTCTGCATTCTCTCGG - Intergenic
1055438860 9:76319580-76319602 GAGCGGTAACGCCAGTGTCTGGG + Intronic
1056467675 9:86874089-86874111 GAGGGGTGTGTCCCGTGTCAAGG - Intergenic
1062048105 9:134433651-134433673 GATGGGTTTCCGCAGGGTCTGGG + Intronic
1062708628 9:137959790-137959812 TAGGAGTTTCTCCAGTGTCGCGG - Intronic
1187498101 X:19813834-19813856 TAAGTATTTCTCCAGTGTCTTGG + Intronic
1188512316 X:30949679-30949701 GAGGGGTGAAACCAGTGTCTGGG - Intronic
1188907116 X:35802288-35802310 GAGGGTCTTCTCCAGAGCCTTGG - Exonic
1189410363 X:40765143-40765165 CAGGGGCTTGTCCAGTGTGTTGG + Intergenic
1189967828 X:46392430-46392452 GAGGGGTCTCTGCATTGTCCAGG - Intergenic
1195783095 X:108485677-108485699 GAGGAGTTTTGCCTGTGTCTGGG - Intronic
1197874347 X:131087796-131087818 TAGGGCTTTCTTCAGAGTCTTGG - Intronic
1200930550 Y:8693127-8693149 GTGGCATTTCTCCACTGTCTTGG - Intergenic
1201471594 Y:14341158-14341180 GAGGGGAGTCTTCAGTGTCATGG + Intergenic