ID: 999175583

View in Genome Browser
Species Human (GRCh38)
Location 5:149629554-149629576
Sequence CAGTGACAGGAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 1, 2: 7, 3: 78, 4: 769}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999175583 Original CRISPR CAGTGACAGGAGAGGGCAGG AGG Intronic
900528385 1:3140462-3140484 CAGAGACAGGCGAGGGGTGGGGG - Intronic
900569682 1:3352154-3352176 CAGTGCCAGGGCCGGGCAGGTGG - Intronic
900621084 1:3588121-3588143 AGGGGACAGGAGGGGGCAGGAGG + Intronic
900621097 1:3588151-3588173 AGGGGACAGGAGGGGGCAGGAGG + Intronic
900621118 1:3588201-3588223 AGGGGACAGGAGGGGGCAGGAGG + Intronic
900621127 1:3588221-3588243 AGGGGACAGGAGGGGGCAGGAGG + Intronic
900621148 1:3588271-3588293 AGGGGACAGGAGGGGGCAGGAGG + Intronic
900621157 1:3588291-3588313 AGGGGACAGGAGGGGGCAGGAGG + Intronic
900626709 1:3611729-3611751 CCGGGACCGGAGAGGGGAGGGGG - Intergenic
901063080 1:6482445-6482467 AAGTGACAGGAGGGAGGAGGAGG + Intronic
901228460 1:7628761-7628783 AAGAGACAGGGGAGGGCAGCAGG + Intronic
901650161 1:10738509-10738531 CACTGCCAGGATAGGCCAGGTGG + Intronic
901759038 1:11458899-11458921 CAGGCCCAGGAGGGGGCAGGAGG - Intergenic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
902251335 1:15155643-15155665 CAGCGACAGGAGAGTGCCTGGGG + Intronic
902288725 1:15423113-15423135 CAGGGACCAGAGATGGCAGGAGG + Intronic
902632248 1:17711893-17711915 CAGCCACATGAGAGGGAAGGGGG + Intergenic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902784247 1:18722715-18722737 CAGTGCCAGCAGGGAGCAGGAGG + Intronic
903259060 1:22121457-22121479 CTGTGACAGGACAGTGCATGGGG - Exonic
903316882 1:22515041-22515063 CAGTGAGAGGACAGGGCTTGGGG + Intronic
903357032 1:22754658-22754680 CCTTGACAAGAGAGGGCGGGTGG - Intronic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
903676477 1:25067721-25067743 ATGGGACAGGACAGGGCAGGTGG + Intergenic
904197144 1:28794412-28794434 CAGTGGCAGGCTAGGGCAGGGGG - Intergenic
904246829 1:29193982-29194004 GAGTGACATGGGAGGGGAGGCGG - Exonic
904287089 1:29459778-29459800 CAGTGACTGGGGGTGGCAGGGGG - Intergenic
904330339 1:29754418-29754440 GATGCACAGGAGAGGGCAGGAGG - Intergenic
904474445 1:30755947-30755969 GAGTGACAGCAGGGGGCAGATGG - Intronic
904495806 1:30885968-30885990 GAGTGACGTGAGAGGGCAGGTGG - Intronic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
904912472 1:33945616-33945638 GAGTGACAGGAGCAGGAAGGAGG - Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905276062 1:36819012-36819034 CAGAGACAGCAGGGAGCAGGAGG - Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
905923509 1:41734097-41734119 CACTGACTGGAGAGGCCAGGAGG - Intronic
907266425 1:53264356-53264378 CAGTGACCCGAAAGAGCAGGAGG - Exonic
907303767 1:53502912-53502934 GGGAGACAGGAGAGGGGAGGGGG + Intergenic
907525151 1:55049696-55049718 CATGGCCAGCAGAGGGCAGGTGG - Intronic
908271826 1:62429904-62429926 CATTGACTGAAGAGGCCAGGAGG - Intergenic
908418429 1:63935679-63935701 CAGTGACAAGACAGGGTAGCAGG - Intronic
908571868 1:65419897-65419919 GAGAGGCAGGAGAGGGAAGGAGG - Intergenic
909567377 1:77068213-77068235 CAGCTACAGGAGAGGGCAACAGG + Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
911121999 1:94305643-94305665 CAGTGCCAATAGATGGCAGGGGG + Intergenic
911313630 1:96328718-96328740 CAGAGGCTGGAGAGGGGAGGGGG + Intergenic
911643637 1:100315820-100315842 CAGTGCCAGCAGAGCACAGGAGG + Intergenic
912090043 1:106061103-106061125 CAATGACAGTAGAAGGCAGTAGG - Intergenic
912739241 1:112178206-112178228 CTGTGAAAGGTGGGGGCAGGGGG - Intergenic
913014516 1:114719066-114719088 CTTTGAGAGGACAGGGCAGGAGG + Intronic
913397800 1:118391678-118391700 CAGTGACAGAGAAGGACAGGAGG + Intergenic
914903859 1:151728318-151728340 CAGAGACAGGAGCTGGCAAGCGG + Intronic
915053513 1:153103142-153103164 CAGTGTTAGGAGTGAGCAGGTGG - Intronic
915290847 1:154882190-154882212 GGGTGACAGGAGAAGCCAGGGGG - Intergenic
915319563 1:155048862-155048884 AAGGGACAGGAGGAGGCAGGTGG + Intronic
915625496 1:157111789-157111811 GAGGGACCAGAGAGGGCAGGAGG + Intergenic
915911510 1:159918470-159918492 CAGAGACAGAACAGGCCAGGGGG + Exonic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916379096 1:164188725-164188747 GAGTGAGAGCAGAGGACAGGAGG - Intergenic
917080493 1:171252521-171252543 CAGGGACAGAACAGGCCAGGTGG - Intronic
917490564 1:175494542-175494564 CACTGACAGCTGAGCGCAGGTGG + Intronic
918099982 1:181364858-181364880 CTTTGATAGGAGTGGGCAGGAGG + Intergenic
918119033 1:181521511-181521533 CAGAGTCAGGAGAAGACAGGAGG + Intronic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918654082 1:187002677-187002699 AATTGAAAGAAGAGGGCAGGAGG + Intergenic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
920778160 1:208961215-208961237 CAGTGACAGCTGTGGGTAGGTGG - Intergenic
921568146 1:216745591-216745613 AAGGGAAAGGAGGGGGCAGGGGG - Intronic
921646178 1:217620933-217620955 CAGTGACTGGTTAGGGCACGTGG - Intronic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922701425 1:227763412-227763434 CAGCAGCAGGACAGGGCAGGAGG + Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922875941 1:228940043-228940065 CAGTGACAGGTGTGGGTTGGGGG - Intergenic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
924519738 1:244795611-244795633 CAGAAACAGGAGAGGGCAGAGGG - Intergenic
924632993 1:245760011-245760033 TAGTGACAGGAGAGGGCAGGAGG + Intronic
1063173536 10:3531271-3531293 AACTAACAAGAGAGGGCAGGAGG - Intergenic
1065130142 10:22612398-22612420 TGGAGAAAGGAGAGGGCAGGTGG + Intronic
1065267442 10:23992439-23992461 GAGTAACAGGAGAGGGATGGAGG + Intronic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG + Intergenic
1066601999 10:37119699-37119721 TAATGACAGGAGATGGCAGCTGG + Intergenic
1067000334 10:42605395-42605417 CAGAGACAGTAGAGGCCAGAAGG + Intronic
1067382509 10:45787812-45787834 CAGTGACAGAAGTGGGGATGTGG - Intronic
1067539326 10:47140315-47140337 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1070083987 10:73216948-73216970 CAGAGATAGGCAAGGGCAGGAGG - Intronic
1070112849 10:73501278-73501300 CAGTGACAGGAGAGAAGATGGGG - Intronic
1070268744 10:74931234-74931256 CAGGGACAGGAGAGGAAAGGAGG - Intronic
1070487558 10:76945038-76945060 AAGTGAGAGGAGAGGGAAAGAGG + Intronic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071196493 10:83166693-83166715 GAGTTAAAGGAGAGGGCAGATGG - Intergenic
1071524575 10:86350946-86350968 TAGAGACTGGGGAGGGCAGGGGG - Intronic
1071728009 10:88218928-88218950 AAATGACAGGTGGGGGCAGGTGG - Intergenic
1072428095 10:95347412-95347434 CAGATAGAGGAGAGGGTAGGAGG - Intronic
1072615662 10:97047651-97047673 TAGGGACAGGGGAGGGCTGGGGG + Intronic
1072951549 10:99850788-99850810 CAGTGACAAGTGAGTGTAGGGGG + Exonic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1074089845 10:110239882-110239904 CAGTGACTGGAAAAGTCAGGAGG - Intronic
1074114918 10:110448741-110448763 CAGTCACAGGATAGGGCTGTGGG + Intergenic
1074766893 10:116706296-116706318 CGGTGTGAGGAGAGGCCAGGCGG - Intronic
1074979543 10:118608615-118608637 CAGTGCCAGGAGAGGATGGGAGG + Intergenic
1075112206 10:119596607-119596629 CAGTGTCCGGAGCGGGCTGGGGG - Intronic
1075118722 10:119648864-119648886 GAGTGACAGGAGGTGGCTGGGGG + Intergenic
1075417899 10:122278923-122278945 TGGTGACAGCAGAGGGCATGAGG + Intronic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076451129 10:130557679-130557701 GAGGGACAGGAGAGAGGAGGTGG + Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076628960 10:131841436-131841458 AGGTGACAGCAGAGGGGAGGGGG - Intergenic
1076698330 10:132257632-132257654 CAGAGAGAGGGCAGGGCAGGGGG - Intronic
1076705062 10:132297022-132297044 CAGTGGCAGGAGAGGACACTGGG - Intronic
1076767176 10:132642582-132642604 GAGTGACAGGGGAGGAGAGGGGG - Intronic
1077014549 11:393883-393905 GAGTGTCAGGGAAGGGCAGGGGG - Intronic
1077286875 11:1770662-1770684 TGGAGACAGGAGAGGCCAGGAGG + Intergenic
1077332163 11:1988514-1988536 GAGGGAGAGGAGGGGGCAGGAGG + Intergenic
1077915668 11:6610097-6610119 CAGAGACAGGACAGGCAAGGGGG + Intronic
1078774579 11:14382626-14382648 TTGTGACAGGAGGAGGCAGGGGG + Intergenic
1078855640 11:15204642-15204664 GAGTGACAGGTGAGTGAAGGTGG + Intronic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079315328 11:19403352-19403374 CAATAACAGGAGATGGCAAGGGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1081249903 11:40816383-40816405 CTGTGACAGGATAGGACAGCTGG - Intronic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1083018198 11:59478109-59478131 CTCAGGCAGGAGAGGGCAGGAGG + Exonic
1083140690 11:60718747-60718769 CAGCGTCAGTAGAAGGCAGGAGG + Intergenic
1083337340 11:61931298-61931320 AAGTGACAGAAGAGGGTTGGAGG - Intergenic
1083365810 11:62140876-62140898 CAGGGTCAGAAGTGGGCAGGCGG - Intronic
1083697654 11:64453463-64453485 CAGGTAAAGGAGGGGGCAGGAGG + Intergenic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1083775163 11:64891102-64891124 CAGGGATAGGGGAGGGCCGGGGG - Intergenic
1083880948 11:65547964-65547986 CAGTGGCAGGAGTAGTCAGGGGG + Exonic
1084117516 11:67050673-67050695 GAGAGAGGGGAGAGGGCAGGGGG - Exonic
1084148278 11:67276324-67276346 GTGGGCCAGGAGAGGGCAGGAGG + Intronic
1084410483 11:69003632-69003654 CAGAGCCAGGAGCAGGCAGGCGG - Intergenic
1084663146 11:70558797-70558819 CAGCTACAGGAGAGCACAGGAGG + Intronic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085298665 11:75445590-75445612 CACTGACAGAGCAGGGCAGGGGG - Intronic
1085391658 11:76185293-76185315 CAGTGCCTGGCCAGGGCAGGTGG - Intergenic
1085481866 11:76829724-76829746 CAGTGACAGGGAAGGGCTGTGGG - Intergenic
1087263730 11:96039348-96039370 AGGAGACAGGAGAGGGGAGGGGG + Intronic
1088379224 11:109174764-109174786 AAGTGACAAGAGGGGGCAGTTGG + Intergenic
1088627123 11:111737451-111737473 CAGTGCCTGGAGAGGACATGGGG - Exonic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088876617 11:113941680-113941702 CAGTGGCAGGAGATGGGAGGAGG + Intronic
1089083931 11:115800844-115800866 CATTCACAGGAGAAGGCAGGGGG - Intergenic
1089356456 11:117857077-117857099 CAGGGACATGAGAGGGCAGGAGG + Intronic
1089491279 11:118885722-118885744 TAGGGACAGGTGGGGGCAGGGGG + Intronic
1089671884 11:120062429-120062451 CAGTGACAGAGGAGGCCCGGAGG + Intergenic
1089744947 11:120610066-120610088 GAGAGACAGGAGAAGGCAGATGG - Intronic
1089774804 11:120828731-120828753 CGGGGACAGGAGAGAGGAGGAGG - Intronic
1090403688 11:126464983-126465005 GAGGAACAGGAGAGGGAAGGAGG - Intronic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1090678520 11:129028315-129028337 CAGTCACAAGCGAGGGAAGGGGG + Intronic
1090789195 11:130075778-130075800 CACTGACAGGACAGAGCAGTAGG - Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1202815144 11_KI270721v1_random:43690-43712 GAGGGAGAGGAGGGGGCAGGAGG + Intergenic
1091532782 12:1375623-1375645 CAGTGACAGGGAATGGAAGGGGG - Intronic
1091588210 12:1827961-1827983 GAGGAACAGGAGAGGGCATGAGG + Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1091768642 12:3137722-3137744 CAGAGAGAGGAGAGGCCAAGAGG - Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1092083708 12:5738581-5738603 AAGTGAAAGAAGAGGGGAGGAGG + Intronic
1092492244 12:8956200-8956222 TGGTGCCAGGAGAGGGCAGGAGG - Intronic
1092903376 12:13080675-13080697 CAGTGACAGGAGAGTAGAGAGGG - Exonic
1094736471 12:33240428-33240450 CAGTGGCAGGAGAGAACAAGGGG - Intergenic
1095361307 12:41343568-41343590 CAGAGACTGGAGAGGGGAAGTGG + Intronic
1095954425 12:47798229-47798251 CAGAGTCAGGAGGGGGCTGGAGG + Intronic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096101716 12:48973813-48973835 CAATGACAGGAGGGGGAAAGTGG + Intergenic
1096188306 12:49598579-49598601 CAGGGAGAGGTGAAGGCAGGTGG - Intronic
1096334228 12:50740978-50741000 CAGCGACAGGAGTGTGCATGAGG - Intronic
1096512259 12:52137558-52137580 GAGTGGGAGGAGAGGGCATGTGG + Intergenic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1097152176 12:56987209-56987231 CCCTGACAGGGGAGGGCAGAGGG - Intergenic
1097192549 12:57226357-57226379 AAGCAGCAGGAGAGGGCAGGTGG - Exonic
1097284743 12:57868781-57868803 CAATGACAGGCGAGGGGAGCGGG + Intergenic
1098271321 12:68773012-68773034 CTGTGACTGGTGAGGGCTGGTGG - Exonic
1099171219 12:79367030-79367052 AAGTTACAGGAGATGGGAGGAGG - Intronic
1099847367 12:88044781-88044803 CAGGAAGAGGAGAGGGCATGGGG + Intronic
1100210494 12:92393748-92393770 CAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1102383163 12:112484493-112484515 CAGGGGCAGGAGGAGGCAGGTGG + Intronic
1102472557 12:113167891-113167913 CAGTGACAGGCAGGAGCAGGAGG - Intronic
1102873254 12:116430495-116430517 CAGTGAGAAAAGTGGGCAGGAGG - Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103023692 12:117556707-117556729 AAGTGAGAGGACAGGGAAGGAGG + Intronic
1103583908 12:121936908-121936930 GAGTGACATGAAAGAGCAGGTGG + Intronic
1103619261 12:122176343-122176365 CAGTGACGCGAGAGGACAGGAGG + Intronic
1103701968 12:122852971-122852993 CAGTGACAGGAGAGAGCCTGGGG - Intronic
1103821034 12:123698931-123698953 CAGTGACAGTACTGGGAAGGAGG + Intronic
1103918649 12:124388515-124388537 GAGAGAGAGGAGAGGGCATGGGG + Intronic
1103995435 12:124826940-124826962 CAATCTCAGGAGAGGGCTGGGGG + Intronic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1105485899 13:20832111-20832133 CAGTTACAGAATAGGGCAGGTGG - Intronic
1105550838 13:21394380-21394402 CGGTGGCATGATAGGGCAGGTGG - Intronic
1105595871 13:21837405-21837427 CAGTGAGAGAAAGGGGCAGGGGG - Intergenic
1105599841 13:21876869-21876891 CAGTGAGAGGTGAAGCCAGGGGG - Intergenic
1105952612 13:25244470-25244492 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1106754380 13:32807794-32807816 CAGTAACAGGTGAGGGCATGGGG - Intergenic
1107103371 13:36617962-36617984 CTGTGACAGGAGAGGTCAATAGG - Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107664230 13:42672647-42672669 CAGGGACAGAGGGGGGCAGGTGG + Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107874445 13:44777713-44777735 CAGGGATGGGAGAGGGTAGGGGG + Intergenic
1108074793 13:46668616-46668638 CATTGTCAGGAGAGGGCAGTTGG + Intronic
1108156386 13:47589692-47589714 CAGTGACAGGAAAAGGGATGGGG + Intergenic
1109620756 13:64901381-64901403 TAGGGACAGGAGAGGGGAGAAGG + Intergenic
1110257326 13:73446038-73446060 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112299027 13:98213496-98213518 CAGTGACATGAGGCGGCTGGAGG + Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1112982624 13:105404545-105404567 GAGGGACAGGGGAAGGCAGGGGG + Intergenic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113734721 13:112670423-112670445 CAGTGACATGAGAGTGGATGGGG + Intronic
1113748924 13:112765210-112765232 CACAGACAGGAGAGGTGAGGAGG + Intronic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1114321518 14:21550608-21550630 CAGTGACAGTTGATGGCAGAAGG + Intergenic
1114411775 14:22507607-22507629 CAGTGACAGGGAAGAGCAGAGGG + Intergenic
1114416446 14:22547989-22548011 AGGTGGCAGGAGAGGGCACGTGG + Intergenic
1114526932 14:23372294-23372316 CAGTGACTGGCGAGGGCAAGGGG + Intergenic
1115289435 14:31753260-31753282 CAGTGGCAGAAGGTGGCAGGTGG + Intronic
1117006474 14:51425757-51425779 GAGTGACAGGAGAGGACAAGAGG - Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118818454 14:69328930-69328952 CAAAGAGAGGAGAGGGTAGGAGG + Intronic
1118894238 14:69932402-69932424 CAGGGACAGGAGGAGGCATGTGG - Intronic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119332130 14:73802708-73802730 AAGTCAAAGGTGAGGGCAGGAGG + Intergenic
1119804774 14:77475552-77475574 CACTGCAGGGAGAGGGCAGGCGG - Exonic
1121030663 14:90656003-90656025 CGGTTCCAGGAGTGGGCAGGCGG - Intronic
1121457631 14:94048790-94048812 CAGATACAGGAGTGGGGAGGGGG + Exonic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121885436 14:97538633-97538655 CAGTGAGAGAAGATAGCAGGAGG - Intergenic
1122101081 14:99410047-99410069 ATGTAACAGGACAGGGCAGGAGG + Intronic
1122173586 14:99898971-99898993 CATTCACAGGACAGGGCAGAGGG - Intronic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122465013 14:101926780-101926802 AAGTGACAGCAGTGGGCAGGAGG - Exonic
1122558188 14:102592612-102592634 CAGCGAGCGGAGAGGGGAGGAGG - Intergenic
1122628617 14:103097353-103097375 CAGTGCCCGGAGAGTCCAGGGGG - Intergenic
1122872858 14:104649088-104649110 CTTTGCCAGGAGAGGGCATGAGG - Intergenic
1123685575 15:22794875-22794897 AGGGGACAGGAGAGGGCCGGGGG - Intronic
1123706014 15:22951591-22951613 TAGTGCCAGGAGAGGCCTGGGGG + Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1125321873 15:38497588-38497610 CAGTGACAGCAAATGACAGGAGG - Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126030185 15:44489162-44489184 CAGAGACAGGGAAAGGCAGGGGG - Intronic
1126317437 15:47385489-47385511 CAGGGAAAGCAGAGGCCAGGTGG - Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1127020846 15:54746743-54746765 CAGAGACTAGAGAGGGTAGGGGG + Intergenic
1127071232 15:55289876-55289898 AGGTGACAGGAGAAGGCGGGAGG - Intronic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1128049526 15:64651671-64651693 CTGTGACAGGAGCTGTCAGGAGG + Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128252770 15:66174487-66174509 ATGTTACAGGAGAGGCCAGGAGG - Intronic
1128557269 15:68640285-68640307 AAAGGAGAGGAGAGGGCAGGGGG - Intronic
1128758020 15:70196401-70196423 CAGTGGCAGGCCAGGGGAGGAGG - Intergenic
1129250998 15:74308956-74308978 CACATACAGGAGAAGGCAGGAGG - Intronic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129737260 15:77973275-77973297 CACTGACAGGAGAGACCTGGGGG - Intergenic
1129746749 15:78027237-78027259 TAGTGACTGGAAAGGGCACGGGG + Intronic
1129848812 15:78780350-78780372 CACTGACAGGAGAGACCTGGGGG + Intronic
1130080972 15:80733180-80733202 CGGGGACAGGGGAGGGAAGGTGG - Intronic
1130148335 15:81292479-81292501 CAGTCACAGGTGAGGCCAGGGGG + Intronic
1130426737 15:83808973-83808995 CAGAGACTGGGGAGGACAGGGGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131131696 15:89904563-89904585 CAGGGCCAGGAGAGAGGAGGGGG - Intronic
1131132271 15:89908032-89908054 CAGATACAGGAAATGGCAGGAGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1131894228 15:97008133-97008155 GAGGGACAGGAGTGGGCAGTGGG + Intergenic
1132302206 15:100782932-100782954 CTGGTACAGGAGAGGGGAGGAGG + Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132582020 16:689128-689150 CAGAGGCAGGTCAGGGCAGGTGG - Intronic
1132940059 16:2502016-2502038 CAGGGCCAGGGGAGGGCACGGGG - Exonic
1132942032 16:2513261-2513283 CAGAGACAGGTGCGGGGAGGGGG + Intronic
1133059592 16:3165670-3165692 CAGTGATAGGTGAGGTCACGTGG + Intergenic
1133240528 16:4411790-4411812 CAGTGAGAGGCGAGGCCAGCTGG + Intronic
1133647245 16:7775849-7775871 CAGGGAGAGGGGAGAGCAGGGGG + Intergenic
1134076242 16:11293560-11293582 CTGTGAAAGGCCAGGGCAGGAGG + Intronic
1134566725 16:15258055-15258077 CGGGGGCAGGAGGGGGCAGGGGG - Intergenic
1134735768 16:16498644-16498666 CGGGGGCAGGAGGGGGCAGGGGG + Intergenic
1134931758 16:18213578-18213600 CGGGGGCAGGAGGGGGCAGGGGG - Intergenic
1135394306 16:22119288-22119310 CAGTGACAGGATAGAGAGGGTGG - Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1136268262 16:29133301-29133323 CAGTGCCAGGAGATGGCCTGGGG - Intergenic
1136517158 16:30775067-30775089 CAGTGCCCGGAGAGGCCAGAGGG + Exonic
1136656501 16:31712362-31712384 CAGTGCCGGGAGAGTGGAGGAGG + Intergenic
1136933143 16:34436470-34436492 CAGTGAGAGGAGAGGGCCCTGGG - Intergenic
1136971429 16:34975344-34975366 CAGTGAGAGGAGAGGGCCCTGGG + Intergenic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138320423 16:56106540-56106562 GAGTGACTGGAGAGAGAAGGTGG - Intergenic
1138423456 16:56914877-56914899 AGGTGAAAGGAGAGGGGAGGAGG + Exonic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139525910 16:67516391-67516413 CAGAGACAAGAGGGGGCAGGCGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1140518259 16:75560220-75560242 CAGTGTCAGGAGATGGCGTGAGG + Intergenic
1140967147 16:79977879-79977901 CAGGCACAGCAGAGAGCAGGTGG - Intergenic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141572278 16:84941261-84941283 AAGAGACTGGAGAGGGCTGGAGG + Intergenic
1141703188 16:85651675-85651697 CAGAGTCAGAAGAGGGCTGGAGG - Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142071574 16:88093639-88093661 CAGTGCCAGGAGATGGCCTGGGG - Intronic
1142109503 16:88323686-88323708 GAGTGGCAGAAGTGGGCAGGGGG + Intergenic
1142176485 16:88647732-88647754 GACTGACAGGAGCGGGCAGAGGG + Intronic
1142415347 16:89938094-89938116 CAATGACAGGTGAGGTCACGTGG + Intergenic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1142470697 17:161778-161800 CAGTGCCAGGAGTAGCCAGGAGG + Intronic
1142582299 17:949693-949715 CAGGGAGAGGAGGAGGCAGGGGG - Intronic
1142788314 17:2243044-2243066 CAGTGGCAGGACGGGGGAGGTGG + Intronic
1142934403 17:3316004-3316026 CAGGGACAGGAGATGGAAAGAGG - Intergenic
1142977967 17:3656452-3656474 GAGGGACAAGACAGGGCAGGGGG - Intronic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143576770 17:7798380-7798402 CAGTGACAAGAGAGGAGAGATGG + Intronic
1143683766 17:8497113-8497135 CAGTAAAAGGAAAGGGCACGAGG - Intronic
1144179076 17:12734974-12734996 CCGTGCAAGGACAGGGCAGGGGG - Intronic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1145252255 17:21303020-21303042 AAATGCCAGGACAGGGCAGGAGG + Intronic
1145973999 17:28973840-28973862 CAGTGACAGGAGGGGACCTGGGG + Intronic
1146305192 17:31725037-31725059 CAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146526509 17:33571522-33571544 CAGTGACAGGAGCTGGGAGAGGG - Intronic
1146632581 17:34481496-34481518 CACTGCAAGAAGAGGGCAGGCGG - Intergenic
1146809333 17:35890750-35890772 AGGTGACAGAAGAGGGGAGGGGG - Intergenic
1146906620 17:36622193-36622215 TAGGGACAGGAGGGGGCAGGAGG - Intergenic
1146926789 17:36751032-36751054 CGGTGACAGGAGGAGGAAGGAGG + Intergenic
1146965524 17:37025489-37025511 CATTGACGGGGGAGGGCAGGAGG + Intronic
1147332474 17:39706969-39706991 CACTGGCAGGAGAGAGCAGATGG - Exonic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147652565 17:42070909-42070931 CAGTGCTGGGAGAGGGCAGTGGG - Intergenic
1147880078 17:43647736-43647758 AAGAGACAGGAGAGGAGAGGTGG - Intronic
1147980315 17:44269975-44269997 CAGAGACAGCTGAGTGCAGGGGG + Intergenic
1148020171 17:44548150-44548172 CAGTTACAGGAAAGGGGAAGGGG + Intergenic
1148052030 17:44774245-44774267 GAGCCACAGGGGAGGGCAGGAGG + Intronic
1148646339 17:49221674-49221696 CCAGGACAGGAGAGGGCTGGAGG + Intronic
1148794298 17:50189787-50189809 CGGTGGCAGGTGAGGGCAGCTGG - Intronic
1149655522 17:58307915-58307937 CAGAGACCGGAGAGGCCAGAGGG - Exonic
1149666847 17:58370920-58370942 CAGTGACAGGCAGGGGCGGGGGG + Exonic
1150328319 17:64274471-64274493 GAGTGACATGGGAGGCCAGGTGG - Intergenic
1150640855 17:66948506-66948528 CAGTGCCGAGAGAGGGCAGTTGG - Intergenic
1151366934 17:73623651-73623673 CAGTGTCAGGTGAGATCAGGGGG - Intronic
1151431230 17:74064728-74064750 CATTTACAGGAAAGGGCAGGTGG - Intergenic
1151973518 17:77471297-77471319 CAGAGACAGCAGGGGGCTGGAGG - Intronic
1152469281 17:80481949-80481971 CAGTGAGTGGGCAGGGCAGGTGG + Intergenic
1152472867 17:80500054-80500076 AGGGAACAGGAGAGGGCAGGAGG - Intergenic
1152573559 17:81130738-81130760 CAGGGACAGGGGTGGGCACGGGG - Intronic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1152699047 17:81810285-81810307 CAGGGAGAGGATAGGGCTGGAGG + Intronic
1153519428 18:5937943-5937965 CAGGCACAGGAGATGGCTGGAGG + Intergenic
1153717063 18:7860448-7860470 CAGTGAGGGAAGAGTGCAGGGGG + Intronic
1153962587 18:10152247-10152269 CAGAGCCAGCAGTGGGCAGGTGG - Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1154050760 18:10954737-10954759 CAGAGACAGGGGAGACCAGGAGG + Intronic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154146823 18:11873803-11873825 GAGTGACAGGAGGTGGCAAGAGG - Intronic
1154425797 18:14271099-14271121 GAGTGAAAGATGAGGGCAGGGGG + Intergenic
1155611136 18:27669155-27669177 CAGTGGGAGGGGAGGGCAAGTGG - Intergenic
1156364197 18:36410168-36410190 CAGGGATTGGAGACGGCAGGGGG - Intronic
1156487880 18:37478106-37478128 CAGGGAGAGGAGAGGAGAGGGGG - Intronic
1157539469 18:48489592-48489614 AAATTCCAGGAGAGGGCAGGAGG + Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1157947923 18:52002081-52002103 CAGGGAAAGGAGATGGCATGAGG - Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1160554420 18:79716697-79716719 CACTCACAGGACAGGGCAGGCGG - Intronic
1160934604 19:1587904-1587926 CAGGGGCAGAAGAGGACAGGAGG - Intronic
1161383902 19:3980901-3980923 CCGTCACAGGGGAGGGCAGGTGG + Exonic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161723311 19:5915339-5915361 GAGTGACAGGCCAGGGCAGCAGG - Exonic
1161813000 19:6481557-6481579 CAGTGACCTGCCAGGGCAGGTGG - Intronic
1162079876 19:8211388-8211410 AAGTGGCAGGACAGGGCTGGGGG - Intronic
1162094806 19:8304028-8304050 CAGGGGCAGGGGAGGCCAGGGGG + Exonic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1162967025 19:14160891-14160913 CAAAGACAGAAGGGGGCAGGAGG - Intronic
1163007189 19:14404436-14404458 CAGCGACAGGGGAGGGCACTGGG + Exonic
1163047471 19:14654804-14654826 GAGTGACAGGGAGGGGCAGGAGG - Intronic
1163257368 19:16164935-16164957 GAGTGACAGCAGGTGGCAGGAGG + Intronic
1163509789 19:17727689-17727711 CGGTCACAGGAACGGGCAGGTGG + Exonic
1163534368 19:17868744-17868766 CAATGACAGAAGCGGGCAGCAGG - Intergenic
1163566546 19:18055208-18055230 CAGAGACAGAGGAGGGGAGGTGG + Intergenic
1163627856 19:18401132-18401154 CAGTGAGAGGTGGGGGGAGGGGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164826872 19:31290382-31290404 CAGAGAGAGGAGATGGCAGGGGG + Intronic
1164914296 19:32038064-32038086 CAGAGACAGAACGGGGCAGGAGG + Intergenic
1165060956 19:33204993-33205015 CAGTGGCAGGACTGGGCATGCGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165265899 19:34663860-34663882 AAGAGACAGGAGAGGACTGGGGG + Intronic
1165273537 19:34730891-34730913 AAGAGACAGGAGAGGACAGCGGG + Intergenic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1165462829 19:35954125-35954147 CAGAGGCAGGAGAGGGCACCAGG - Intergenic
1165749603 19:38251990-38252012 CAGTGACAGGGGAGGACAGAGGG + Intronic
1165859441 19:38899593-38899615 CGGTGACAGGACAGAGCAGTCGG - Exonic
1166154386 19:40899948-40899970 CAGGCACAGGGGAGGGCAGAAGG - Intergenic
1166164439 19:40977483-40977505 CAGCAAGAGGAAAGGGCAGGAGG - Intergenic
1166186339 19:41141565-41141587 CAGCAAGAGGAAAGGGCAGGAGG + Intergenic
1166258137 19:41620250-41620272 CAGAGACAGGAGTGAGCAGCAGG + Intronic
1166283547 19:41810293-41810315 CAGAGACAGGAGTGAGCAGCAGG - Intronic
1166347645 19:42176530-42176552 TAGAGAGAGGAGAGGGCAGTCGG - Intronic
1166880714 19:45928400-45928422 GAGTGAGAGGCAAGGGCAGGTGG + Intergenic
1166885911 19:45960888-45960910 CAGTGACAGTGGTGGGGAGGGGG - Intronic
1167158734 19:47754670-47754692 CAGTGTCAGGGGTGGGTAGGAGG - Intronic
1167225709 19:48238132-48238154 CACTGGGAGGCGAGGGCAGGTGG - Intronic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167439424 19:49499914-49499936 CAGAGACCGGAGGGGGCGGGGGG - Intergenic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167924920 19:52813580-52813602 GAGGGACAGGAGCAGGCAGGAGG - Intronic
1167989202 19:53343497-53343519 CATTGGCAGGTGGGGGCAGGGGG - Intronic
1168453366 19:56483926-56483948 CAGTAATGGGAGGGGGCAGGGGG - Intergenic
925091105 2:1156656-1156678 CCATGACAGGTGAGGGCAGAAGG + Intronic
925182271 2:1825001-1825023 CAGAGAAGGGAGAGGACAGGAGG + Intronic
925909934 2:8567185-8567207 CAGAGACAGGTGGGGGCAGGTGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926237648 2:11058207-11058229 AAGTCAAAGGAAAGGGCAGGAGG + Intergenic
926498612 2:13622788-13622810 CAGTGAGTGGAGTGGGAAGGTGG + Intergenic
926635234 2:15171330-15171352 CAGTTACTGGAGAGGAAAGGAGG - Intronic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927364705 2:22280927-22280949 AAGTGACAGCAGAGTACAGGAGG + Intergenic
928029439 2:27766174-27766196 CAGTGACAGGGGTGGGGAGAGGG - Intergenic
928099950 2:28431160-28431182 GTGTGAGAGGAGAGGACAGGAGG - Intergenic
928242333 2:29597238-29597260 CAGTGACAGAGGTGGGCAGCAGG + Intronic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929228291 2:39533206-39533228 CTGAGACAGGAGAGAGCAGTGGG - Intergenic
929410789 2:41695918-41695940 AATAGACAGGAGAGGGCAGTTGG - Intergenic
929950698 2:46407515-46407537 CAGTGCCTGGGGAGGCCAGGTGG + Intergenic
930140339 2:47945064-47945086 GAGTGACAGGAGAAGCCAGTTGG - Intergenic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932569008 2:72927868-72927890 CAATGACAGCAGAGAGCAAGGGG - Intronic
932703679 2:74007379-74007401 CAATGACAGAGGAGGGCAGTGGG + Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933299939 2:80530227-80530249 CAGTGCCGGGGGTGGGCAGGAGG - Intronic
933765629 2:85706743-85706765 GAGTGGCAGGAGAGGGCAAGAGG - Intergenic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
934576822 2:95407169-95407191 CAGTGACTAGGGAGGGCAGTGGG - Intronic
934639042 2:96015337-96015359 CAGTGACTAGGGAGGGCAGTGGG - Intergenic
934794606 2:97090075-97090097 CAGTGACTAGGGAGGGCAGTGGG + Intronic
934882302 2:97995258-97995280 CAGTGACAGGAGACGGGGGAAGG + Intronic
935147443 2:100405474-100405496 CAGAGAGAGGATGGGGCAGGAGG + Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
936050186 2:109216660-109216682 CACTGGCTAGAGAGGGCAGGAGG - Intronic
936271484 2:111052761-111052783 GAGTCACAGGCGAGTGCAGGTGG - Intronic
936433856 2:112486273-112486295 CAAGGACAGGGCAGGGCAGGGGG + Intronic
936472431 2:112811148-112811170 CAGTGACCTGAGATGTCAGGGGG + Intergenic
936518705 2:113198662-113198684 CAGCCACAGGAGGGGGCGGGAGG + Intronic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937696107 2:124810426-124810448 CAGATACAGTGGAGGGCAGGGGG + Intronic
937911661 2:127078534-127078556 GAGTGGCAGCAGGGGGCAGGTGG + Intronic
938021674 2:127910905-127910927 CAGTGACATGAGAGGGACAGGGG - Intergenic
938771019 2:134500811-134500833 CAGAGACTGGGGAGGGGAGGGGG + Intronic
938866239 2:135423660-135423682 CAGTCACAGTGGAGGGTAGGGGG + Intronic
939097639 2:137852733-137852755 CATTGGCAGTAGAGTGCAGGGGG - Intergenic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
940788967 2:158011753-158011775 CATAGACAGGAGAGGAAAGGAGG - Intronic
940812641 2:158262660-158262682 TAGTGGCAGGAGAGAGCAAGGGG + Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946195401 2:218029760-218029782 TAGTGACTGGAAGGGGCAGGAGG + Intergenic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
947795547 2:232891820-232891842 TAGTGACAGGAACGGGCAGCAGG + Intronic
947828533 2:233123039-233123061 CACTGAGAGGAGAGTGAAGGAGG + Intronic
947874210 2:233457780-233457802 GAGAGACAGGAGAGGGCTGCAGG + Intronic
948335622 2:237204828-237204850 CAGTGACACTGGAGGACAGGTGG + Intergenic
948448569 2:238053780-238053802 TAGAGACAGGAATGGGCAGGAGG + Intronic
948483974 2:238268334-238268356 GAGGGACCGAAGAGGGCAGGGGG - Intronic
948603466 2:239120557-239120579 CAATGCCAGGAAAGGGCAAGGGG + Intronic
948691267 2:239706613-239706635 CAGAGACAGGCGTGGGAAGGGGG + Intergenic
948855250 2:240727312-240727334 AAGGGAGAGGGGAGGGCAGGAGG + Intronic
948888536 2:240896006-240896028 CAGTGGCAGGTGAGGGCCAGTGG + Exonic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
1169110538 20:3030210-3030232 TAGTGAGAGTAAAGGGCAGGGGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1170480109 20:16756847-16756869 AAGAGAGAGGAGAGGGGAGGAGG + Intronic
1170681264 20:18527740-18527762 CAGTGACTGGGGAGGGCCTGTGG + Intronic
1170833215 20:19861297-19861319 CAATGACAGTAGAGTGCAGCTGG - Intergenic
1171167707 20:22986547-22986569 CAGAGCCGGGGGAGGGCAGGGGG + Intergenic
1171231432 20:23489835-23489857 CCCTGGCAGGACAGGGCAGGGGG + Intergenic
1171971766 20:31569315-31569337 CAGCTCCAGGACAGGGCAGGGGG + Exonic
1171981460 20:31632125-31632147 CCGGGACAGGACAGGACAGGTGG - Intergenic
1172965731 20:38833294-38833316 CAGGGACAGGAGTGGGTTGGAGG + Intronic
1173167524 20:40696102-40696124 CAGGGAGAGGAGGGGGCTGGAGG - Intergenic
1173175878 20:40764449-40764471 CAGTGGCTGGAGAGGACAAGTGG + Intergenic
1173459759 20:43233771-43233793 CAGTGACTGCATTGGGCAGGTGG - Intergenic
1173628963 20:44495661-44495683 CTGTGTAAGGAGGGGGCAGGGGG - Intergenic
1174109216 20:48186421-48186443 CAGTGAGAAGAGAGGCCAGCAGG - Intergenic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1175296706 20:57913615-57913637 GAGAGACAGGAGGGGACAGGAGG + Intergenic
1175379980 20:58556231-58556253 CAGTGAGAGCAGAGGGCCAGAGG + Intergenic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1176040436 20:63062647-63062669 GAGTGACAGGGAAGGGCCGGGGG - Intergenic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176666272 21:9690238-9690260 CAGCGCCAGGATTGGGCAGGAGG - Intergenic
1177697295 21:24589986-24590008 AAGGGACAGAAGAGGGCTGGAGG - Intergenic
1178267911 21:31161381-31161403 CAGTCACAGGAGAGAGGAGGCGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179528605 21:42001936-42001958 CAGAGACAAGACAGAGCAGGAGG + Intronic
1179542385 21:42091924-42091946 CAGTGCCAGGTCAGTGCAGGAGG + Intronic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1180749443 22:18114020-18114042 CAGTGATGGGGGTGGGCAGGAGG + Intronic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1180855395 22:19041877-19041899 CAGTGACAGGATGAGGAAGGAGG + Exonic
1180956525 22:19743744-19743766 CAAAGGCAGGCGAGGGCAGGAGG + Intergenic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181748169 22:24970328-24970350 CAGAGAGAGGAAAGGGCTGGGGG + Intronic
1181855089 22:25775544-25775566 CAGCGAGGGAAGAGGGCAGGAGG - Intronic
1181947482 22:26529451-26529473 CAGGGAGGGGAGAAGGCAGGTGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182307761 22:29382825-29382847 AAGTCACAGGAGAATGCAGGGGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182617747 22:31599717-31599739 CAGTGAGAGGCCATGGCAGGAGG - Intronic
1183035350 22:35136916-35136938 CATTGAGAGGTGAGGGCAGGTGG - Intergenic
1183191676 22:36325603-36325625 CGGTGGCAGGTGAGGGCAGCCGG + Intronic
1183196761 22:36358745-36358767 AAGTGGCAGGGGAGGCCAGGAGG - Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183706111 22:39475744-39475766 GACTGAACGGAGAGGGCAGGAGG - Intronic
1183744260 22:39684329-39684351 CATGGGCAGGAGAGGGCTGGAGG - Exonic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184302743 22:43572034-43572056 CACTGATGGGACAGGGCAGGAGG + Intronic
1184358987 22:44002497-44002519 AAGTGGCAGGAGGGGGCAGTGGG + Intronic
1184748629 22:46471780-46471802 CTGGGACAGGAGAGGACAGTGGG - Intronic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185228059 22:49664376-49664398 GAGTGACGGGAGATGCCAGGAGG - Intergenic
1185245338 22:49770148-49770170 CAGGGACAGGAGTGGTCCGGGGG + Intergenic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
949875127 3:8621495-8621517 CTGTCAGAGGAGAGGCCAGGGGG + Intronic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950100346 3:10352791-10352813 CAGGGGCAGGAGACAGCAGGGGG - Intronic
950136502 3:10584774-10584796 CAGTGACACGAGTAAGCAGGTGG - Intronic
952167502 3:30766708-30766730 TAAAGACAGGAGAGAGCAGGTGG + Intronic
952634696 3:35514104-35514126 CAGAGACTGGGGAGGGTAGGAGG - Intergenic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
952888923 3:38028644-38028666 AAGTGACCTGGGAGGGCAGGAGG + Intronic
953371581 3:42393062-42393084 CAGGAACAGGAGAATGCAGGAGG + Intergenic
953386600 3:42509845-42509867 CACAGAGAGGAGGGGGCAGGTGG - Intronic
953511010 3:43539144-43539166 CAGTACCAGGAGGGAGCAGGAGG - Intronic
953635567 3:44660918-44660940 AAGTGATGGGAGAGGGGAGGTGG + Intergenic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
954155678 3:48683773-48683795 CAGGGCCAGGGGAGGGCTGGGGG - Intronic
954346513 3:50004310-50004332 CAATAAGAGGAGAGGGGAGGGGG - Intronic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955386799 3:58487086-58487108 GAGAGAGAGGAGAGGGGAGGAGG + Intergenic
955976787 3:64487515-64487537 CAGTGAGAGGAGATGTCTGGGGG - Intergenic
958128100 3:89383494-89383516 CAGTTCCAGCACAGGGCAGGTGG - Intronic
960084694 3:113578053-113578075 CAGTGGCAGGAGAGGGCCAAAGG + Intronic
960170467 3:114454783-114454805 CACAGACAGGAGAGAGGAGGAGG - Intronic
961017895 3:123481703-123481725 CTGTGACAGGGAAGGGCTGGTGG - Intergenic
961454738 3:127018285-127018307 CACTGGCAGGTGCGGGCAGGTGG + Exonic
961464206 3:127071647-127071669 CAGGGACAGGGTGGGGCAGGTGG + Intergenic
961863780 3:129938785-129938807 GAGTGAGAGAAGAGGGCTGGGGG - Intergenic
962290267 3:134129956-134129978 CAATGACAGAACAGGGAAGGGGG - Intronic
962400953 3:135058350-135058372 AAGGGACAGGAGAGGAGAGGTGG - Intronic
962458020 3:135583108-135583130 CAGTGACAGCAGAGGCTGGGTGG - Intergenic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
963432195 3:145222545-145222567 AAGGGACAGGAGAAGTCAGGTGG + Intergenic
963933452 3:151027980-151028002 AAGTGACAGGAAAGGCCTGGTGG - Intergenic
964997228 3:162897391-162897413 CAGAGACAGGGTAGGGCAGGAGG + Intergenic
966290415 3:178349562-178349584 CAGTGAGAGGTGAGGCCAGCTGG - Intergenic
966808521 3:183824754-183824776 CAGTGACCGGAGAGAGCTGGGGG + Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
967991747 3:195136586-195136608 CAGTGACATAAGAACGCAGGTGG - Intronic
968624857 4:1622511-1622533 CAGTCACAGGGCAGGGCTGGTGG - Intronic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968728159 4:2257775-2257797 TAGAGGCAGGAGATGGCAGGAGG - Intronic
968925241 4:3543529-3543551 CAAGCACAGGAGATGGCAGGTGG - Intergenic
968967231 4:3775287-3775309 ATGTGCCGGGAGAGGGCAGGAGG + Intergenic
969091128 4:4694732-4694754 CAGTCACAGGAGAGGTAATGAGG - Intergenic
969307735 4:6335456-6335478 CAGAGAAAGGAGTGAGCAGGGGG + Intronic
969441987 4:7222711-7222733 CTGTGGCAGGAGAGAGCGGGAGG + Intronic
969661952 4:8535565-8535587 GATTGTCAGGTGAGGGCAGGAGG - Intergenic
970009430 4:11443126-11443148 CAGTGACAGAAAAGCACAGGGGG - Intergenic
970603936 4:17661811-17661833 GAGTCCCAGGAGAGGGGAGGGGG + Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
971473817 4:27053903-27053925 CAGTTACAGGGAAGGGCTGGTGG + Intergenic
971943724 4:33247043-33247065 AGGTGACAGGAGAGAGAAGGAGG + Intergenic
972783578 4:42306905-42306927 CAGTGACAGCAGCCGGCAGATGG - Intergenic
973334802 4:48945051-48945073 CAGTGGCAGGAAATGGGAGGTGG + Intergenic
973698817 4:53516850-53516872 CCAAGACAGGAGAGGGGAGGAGG + Intronic
973794250 4:54407666-54407688 CAGTAACGGGAAAGGGAAGGGGG - Intergenic
974251274 4:59387970-59387992 CAGTAACAGGATCTGGCAGGGGG + Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975757019 4:77580881-77580903 CAGTGAAAGGGAAGGCCAGGGGG - Intronic
976714388 4:88107945-88107967 CAGTGACAGGAGATGGGTAGTGG - Intronic
978005409 4:103609747-103609769 GAGTGGCAGGAGAGGGGATGGGG - Intronic
978338958 4:107701216-107701238 CAGGAACAAGAGAGGTCAGGTGG - Exonic
979362855 4:119784637-119784659 TGGTGACAGGAGAGGGAAGCAGG + Intergenic
980791976 4:137632161-137632183 CAGTGGCAGCACAGAGCAGGGGG - Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
980838773 4:138231179-138231201 CAGAGAGATGAGAGGGTAGGAGG + Intronic
981342961 4:143643647-143643669 CAGAGACTGGGGAGGGCAGTTGG + Intronic
981724107 4:147829937-147829959 GAGTGCCAGGAGAGAGAAGGTGG + Intronic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
983891372 4:173033624-173033646 AAGTGAATGGAGTGGGCAGGAGG - Intronic
984073509 4:175146932-175146954 CAGTGACAGGAAAGGCTAGCCGG + Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985408749 4:189662098-189662120 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
985627577 5:997851-997873 CAGAGCCAGGTGAGGGCAGATGG - Intergenic
986334500 5:6743305-6743327 GAGCGGCAGGAGATGGCAGGAGG - Intronic
986520050 5:8605579-8605601 CAGTAGCAGGATGGGGCAGGGGG - Intergenic
986730412 5:10631193-10631215 CTGAGACATGGGAGGGCAGGAGG + Intronic
986822497 5:11482863-11482885 GAGTGAGGGGAGAGAGCAGGGGG + Intronic
987524770 5:19032998-19033020 CAGAGACTGGGGAGGGGAGGTGG + Intergenic
988839214 5:35066732-35066754 GAGTGAGAGGAGGAGGCAGGAGG - Intronic
990245403 5:53859215-53859237 CAGCCACAGGAGGGTGCAGGAGG - Intergenic
991592350 5:68266157-68266179 TAGTATTAGGAGAGGGCAGGGGG - Intronic
992708239 5:79420483-79420505 AAGTGAGGGAAGAGGGCAGGCGG - Intronic
992738389 5:79746835-79746857 CAGTGTCAGGACAGGGATGGAGG - Intronic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
995123982 5:108561907-108561929 TCATTACAGGAGAGGGCAGGCGG + Intergenic
996087355 5:119318683-119318705 GAGGGACAGGAGAGGGGAGGGGG - Intronic
996199885 5:120658916-120658938 CAAGGACTGGGGAGGGCAGGAGG - Intronic
996485095 5:124024295-124024317 CAGTAACTAGAGAGGGCAGCTGG - Intergenic
997159977 5:131597691-131597713 CAGAGACTGGAGTGGGGAGGTGG + Intronic
997294567 5:132761625-132761647 CACTGAAAGCAGAGGGCCGGTGG + Exonic
997694358 5:135849819-135849841 CAGGGAGAGGAGATGGCATGTGG + Intronic
997942223 5:138168512-138168534 CTCTGACAGCAGAGGGGAGGGGG + Intronic
998053890 5:139057481-139057503 GACTGCCAGGAGGGGGCAGGTGG - Intronic
998093580 5:139384490-139384512 GAGGGAGAGGAGAGGACAGGCGG - Intronic
998173197 5:139884320-139884342 CAGGGACAAGTGAGGGGAGGAGG + Intronic
998735571 5:145136096-145136118 CAGAGACTGGAGAGGGTAGAGGG - Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999261626 5:150242023-150242045 CAGTGACAGGATGGGACATGGGG + Intronic
999681017 5:154060092-154060114 CAGTCACAGAAGCAGGCAGGGGG + Intronic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1000070021 5:157731704-157731726 CCGTGACTGGAGCGGGCGGGAGG - Intronic
1000364234 5:160476316-160476338 CAGGGACAGGTGGGGGCTGGGGG + Intergenic
1001109689 5:168885410-168885432 CGATGACAGCAGAGGTCAGGCGG + Intronic
1002354530 5:178614448-178614470 CAGCTACAGGGGAGGGCAGTGGG + Intronic
1002638620 5:180620045-180620067 CAGGGACAGGTCAGGCCAGGCGG + Intronic
1003550857 6:7100998-7101020 CAGAGACAGGAGATGTCAAGGGG - Intergenic
1003757334 6:9136484-9136506 CAGTGACAGGAGAGTATGGGTGG + Intergenic
1003965209 6:11246374-11246396 CAGTGACAGGCAAAGGCAGATGG + Intronic
1003973599 6:11322444-11322466 CAGAGGCAGGAGAGGTCAAGGGG + Intronic
1004495209 6:16156436-16156458 CAATGGCAGGAGAGTGAAGGTGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1005089178 6:22038443-22038465 CAGTGAGAGGAAGGGGAAGGAGG - Intergenic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005677760 6:28173197-28173219 CATTGGGAGGACAGGGCAGGAGG + Intergenic
1005930635 6:30481525-30481547 CAGGGATTGGAGATGGCAGGGGG + Intergenic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006502826 6:34469085-34469107 AAGGGACAGGAGAGGACATGAGG + Intronic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007094033 6:39202433-39202455 GGTTGAGAGGAGAGGGCAGGGGG + Intronic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008759164 6:54833457-54833479 CAGTCACTGGAGAGAGGAGGGGG + Intergenic
1011577522 6:88819323-88819345 CAGTAACAGGAAAGGCAAGGCGG + Intronic
1012183851 6:96189217-96189239 CAGGGAGAGGTGAGGGCTGGTGG + Intronic
1013339245 6:109197228-109197250 CAGTCCCAAGAGAGTGCAGGTGG - Intergenic
1013346571 6:109266096-109266118 GTGTGACAGGATAGAGCAGGGGG - Intergenic
1013388358 6:109655864-109655886 CAGTGACAGGAGAGGTGGGGAGG + Intronic
1014311719 6:119812097-119812119 CTGTGACTGGAGAAGACAGGAGG - Intergenic
1014637200 6:123862228-123862250 CAGTGACATGAGGGAGCATGAGG - Intronic
1015156432 6:130101607-130101629 CAGGGCCTGGAAAGGGCAGGGGG + Intronic
1015543388 6:134338582-134338604 AAGGGAGAGGAGAGGGCTGGTGG + Intergenic
1015797983 6:137032237-137032259 CAGTGGCAGGAGACAGCTGGTGG + Intronic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1017247919 6:152247232-152247254 CAATAACAGCAGAGGGCATGGGG - Intronic
1017513342 6:155133602-155133624 CAGGGGCAGGAGAGGGCAATGGG - Intronic
1017772890 6:157656747-157656769 CAGTCACAGCAGAGAACAGGAGG - Intronic
1018225345 6:161622661-161622683 CAATCCCAGGAGAGGGCATGAGG - Intronic
1018443548 6:163834699-163834721 CCGTGCCAGGAGTGGCCAGGAGG + Intergenic
1018757178 6:166860354-166860376 CAGCCCCAGGAGAGGGCAGATGG - Intronic
1018768944 6:166955968-166955990 CAGCGACTGGGGAGGGCGGGGGG - Intronic
1018891837 6:167988313-167988335 CAGAGGCAGGAGGAGGCAGGAGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019427309 7:983694-983716 TAGGGACAGCAGAGGGGAGGAGG + Intronic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1019608193 7:1920688-1920710 CAGTGAGAAGAGAGGACAGGAGG + Intronic
1019652941 7:2170389-2170411 CAGGGAAAGGGGAGGGCAAGTGG + Intronic
1019778525 7:2926326-2926348 CAGAGACAGGAAAGAACAGGAGG - Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021776378 7:24059038-24059060 CAGCGAAAGGAGAGAGAAGGAGG + Intergenic
1021933018 7:25600629-25600651 AAGAGATAGGAGACGGCAGGAGG - Intergenic
1022450326 7:30507839-30507861 CAGTGACAGGTGAAGCCAGCTGG - Intronic
1022506131 7:30909641-30909663 CAGGGACAGGTGAGGGGAGGAGG + Intergenic
1023593986 7:41809704-41809726 CATTGACAGGAGAGGAGAGGTGG + Intergenic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1024344624 7:48300614-48300636 CAGAGACAGGAGTGAGCAGAAGG + Intronic
1024683876 7:51723705-51723727 CAATGAAAGGAAAGGGAAGGGGG - Intergenic
1025252780 7:57363023-57363045 CAGTGACAGGACAAGGGCGGCGG + Intergenic
1026773604 7:73217510-73217532 TGGTGACAGGAGAGAGCGGGAGG - Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027014463 7:74770904-74770926 TGGTGACAGGAGAGAGCGGGAGG - Intergenic
1027073570 7:75175053-75175075 TGGTGACAGGAGAGAGCGGGAGG + Intergenic
1027633305 7:80636164-80636186 CAGAGAACGGAGAGGGGAGGAGG + Intronic
1028398846 7:90403304-90403326 CAGAGAAAGGGAAGGGCAGGAGG + Intronic
1028885355 7:95926821-95926843 GAGTCTCAGGAGAGGGCAGGTGG - Intronic
1028920337 7:96303727-96303749 CACTGACATGGGAGGGCAGGAGG - Intronic
1029628355 7:101734453-101734475 GCGCTACAGGAGAGGGCAGGTGG - Intergenic
1030386319 7:108871730-108871752 AAGGGTCAGGAGAGGCCAGGAGG + Intergenic
1030794427 7:113770350-113770372 CAGTCAGAGGAGAGCCCAGGCGG - Intergenic
1030836750 7:114297088-114297110 CAGGGAGAGGGCAGGGCAGGGGG + Intronic
1031121539 7:117727980-117728002 CAGTGACAGGAGGTGGCACAAGG + Intronic
1031164812 7:118215103-118215125 CAGAGCCAGAAGAGGACAGGAGG - Intronic
1031995777 7:128229906-128229928 CACTGGCAGGGGAGGGAAGGAGG + Intergenic
1032010935 7:128347496-128347518 AGGTGATAGGAGTGGGCAGGAGG - Intergenic
1032706405 7:134424035-134424057 CTGTGAGGGAAGAGGGCAGGTGG + Intergenic
1033035954 7:137876590-137876612 CAGTTACAGGAGAGAGTAGGTGG - Exonic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034437428 7:151069878-151069900 CAGTGGCAGGAGATGGGATGGGG - Intronic
1035094818 7:156345686-156345708 CTGAGACAGGAGAGAGCACGAGG - Intergenic
1035182222 7:157097703-157097725 CAGGGACAGGCGGTGGCAGGTGG + Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036047539 8:5160587-5160609 TGGAGACAGGAGAGGGCAAGGGG - Intergenic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036661302 8:10710833-10710855 CAATGACAGGACAAAGCAGGAGG + Intronic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1038459203 8:27702377-27702399 CAGTGCCAGGACTGGGCAGCGGG - Intergenic
1039370727 8:36981579-36981601 CTGTCAGAGGAGAGGACAGGAGG - Intergenic
1039475095 8:37835466-37835488 CAGTGAGAGGAGGTGGGAGGAGG + Intronic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1040466807 8:47702918-47702940 CAGTCTCAAGGGAGGGCAGGAGG + Intronic
1041128987 8:54676328-54676350 CAGTAATAGGAGAGGGTAGTAGG + Intergenic
1042875891 8:73439558-73439580 CAGTGACAGGGGTGGGAAAGAGG + Intronic
1042920345 8:73913585-73913607 GATTGACAGGTGAGGGCAGCTGG + Intergenic
1042939756 8:74095849-74095871 CAGGGACAGGTGTGGGCTGGAGG - Intergenic
1044892503 8:96852183-96852205 CAGTAACAGGCAAGGGCAAGTGG - Intronic
1044927322 8:97220753-97220775 AAGAGACAGCAGAGGGGAGGTGG - Intergenic
1044944861 8:97380456-97380478 AAGTGACAGGTGAGTGAAGGGGG - Intergenic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045850885 8:106697094-106697116 CAGAGACAGAACAGGCCAGGGGG + Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1048593729 8:135845111-135845133 CAGGGACAGGATAGGGAAGCTGG + Intergenic
1048907983 8:139106648-139106670 TAGAAACAGGAGAGGGCAGATGG - Intergenic
1048927969 8:139287752-139287774 CAAGGGCAGGAGTGGGCAGGGGG - Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049151429 8:141037745-141037767 GAGTGACGGGCTAGGGCAGGTGG - Intergenic
1049235217 8:141508756-141508778 AGGTGACAGGAGGGGCCAGGTGG + Intergenic
1049292493 8:141812001-141812023 AAGAGAAAGGAGATGGCAGGAGG + Intergenic
1049764382 8:144347081-144347103 CTTTGACAGGACAAGGCAGGAGG - Intergenic
1049823041 8:144647737-144647759 CCGTGCCAGGGGAGGGCAGCTGG + Intergenic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1050259824 9:3829252-3829274 AACTGACAGGAGAGACCAGGTGG - Intronic
1051343094 9:16129206-16129228 CAGGGACAGGACTGGGCAGAGGG + Intergenic
1051536753 9:18167724-18167746 TATTGACAGGAGTGGGGAGGAGG - Intergenic
1052437214 9:28444340-28444362 CAGTGCCAGCAGAGAACAGGAGG - Intronic
1052978808 9:34432089-34432111 CACAGCCAGGAGATGGCAGGGGG + Intronic
1053022633 9:34706274-34706296 CAGTGACAGGAGAGGAGAGTTGG + Intergenic
1053382636 9:37661242-37661264 CAGAGGCAGGAGGGTGCAGGGGG + Intronic
1053586114 9:39460819-39460841 GAGTGACAGGACAAGGAAGGTGG + Intergenic
1053800131 9:41758711-41758733 CAAGCACAGGAGATGGCAGGTGG - Intergenic
1053868200 9:42462926-42462948 AATTGACAGGAGATGCCAGGAGG - Intergenic
1054145061 9:61556124-61556146 CAAGCACAGGAGATGGCAGGTGG + Intergenic
1054188559 9:61970863-61970885 CAAGCACAGGAGATGGCAGGTGG - Intergenic
1054464757 9:65487081-65487103 CAAGCACAGGAGATGGCAGGTGG + Intergenic
1054580195 9:66904412-66904434 GAGTGACAGGACAAGGAAGGTGG - Intronic
1054649962 9:67617754-67617776 CAAGCACAGGAGATGGCAGGTGG + Intergenic
1054798685 9:69325587-69325609 AAGTGACAGCAGCGGGCGGGCGG - Intronic
1054913210 9:70473043-70473065 CAGAGACAGGAGAGGTCACATGG - Intergenic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056753393 9:89367641-89367663 CAGTGACAGGAAGGGCCAGGGGG - Intronic
1057397099 9:94689965-94689987 CAGGGAGAGGGGAGGTCAGGTGG + Intergenic
1057423546 9:94930543-94930565 AAGTGAGAGAAGAGGTCAGGAGG + Intronic
1059431417 9:114252666-114252688 CTGCAACAGGAGAGGGCAAGAGG - Intronic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1060211306 9:121712141-121712163 CAGAGAGAGGAGAGGGCACTGGG + Intronic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060543408 9:124446916-124446938 CAGTGACAAGTGGGGACAGGTGG + Intergenic
1060668317 9:125446791-125446813 CAGTGACAAGCGGGAGCAGGTGG - Intronic
1060690712 9:125656833-125656855 CAGAGACACAAGAAGGCAGGGGG + Intronic
1060861347 9:126957251-126957273 CAGTGACAGAAGAGGGCCTGAGG + Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061066200 9:128279133-128279155 AAGAGGCAGGAGAGGTCAGGAGG - Intronic
1061215199 9:129217739-129217761 CAAGGTCAGGAAAGGGCAGGTGG + Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061531986 9:131221601-131221623 AAGTGAAAGGAGAGGACTGGAGG - Intronic
1061716238 9:132520131-132520153 GAGTGAGAGGAGAGGGGAGGGGG - Intronic
1061795117 9:133081866-133081888 GAGTGACAGGAGAGAAAAGGAGG - Intronic
1061858321 9:133455264-133455286 CACTGCCAAGAGAGGGGAGGAGG - Exonic
1062004435 9:134232114-134232136 CAGCCCCAGGGGAGGGCAGGAGG - Intergenic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1062137298 9:134936241-134936263 CAGTGACAAGAGACAGCTGGGGG + Intergenic
1062514677 9:136926682-136926704 CTGTGAGAGGAGAGGCCAGGAGG - Intronic
1203659827 Un_KI270753v1:31523-31545 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185673161 X:1827307-1827329 CTGTTACAGGTGAGGCCAGGTGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186532851 X:10314690-10314712 GAGAGGCAGGAGAGGGAAGGTGG + Intergenic
1187426827 X:19185355-19185377 GAGAGAAAGGAGAGGGGAGGAGG - Intergenic
1187518350 X:19991750-19991772 CAGTGACAAGGGAGGGCAAAAGG - Intergenic
1189285050 X:39846225-39846247 GAGTGACTGGAGGGGGCAGAAGG - Intergenic
1189516769 X:41720330-41720352 CACTTCCTGGAGAGGGCAGGGGG + Intronic
1190047342 X:47123272-47123294 CAGTGATTGTGGAGGGCAGGGGG + Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1191858206 X:65644593-65644615 CAGTGGCAGCTCAGGGCAGGGGG + Intronic
1192324662 X:70122439-70122461 CAGAGACGGGAGGGGGGAGGGGG - Intergenic
1192469999 X:71390257-71390279 CAGTGACAGGAGATGAAAGGAGG - Intronic
1192509118 X:71711784-71711806 GAGTGGCAGGACAAGGCAGGAGG + Intergenic
1192511609 X:71723393-71723415 GAGTGGCAGGACAAGGCAGGAGG - Intergenic
1192515088 X:71758112-71758134 GAGTGGCAGGACAAGGCAGGAGG + Intergenic
1192517579 X:71769769-71769791 GAGTGGCAGGACAAGGCAGGAGG - Intergenic
1192528332 X:71867021-71867043 GAGTGGCAGGACAAGGCAGGAGG + Intergenic
1193022761 X:76808926-76808948 CAGAGACTGGAAAGGGCAGTGGG + Intergenic
1193056727 X:77160082-77160104 CAGTGATGGGAGAGAGCAGATGG - Intergenic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1196205210 X:112931586-112931608 CAGTGACAGGAAAGGAGAGAGGG - Intergenic
1196812624 X:119640764-119640786 CAATGACAGCAAACGGCAGGTGG + Exonic
1197115234 X:122824417-122824439 CAATGACAGGTGATGGGAGGAGG + Intergenic
1197169698 X:123418199-123418221 CATTGAAAGGAGAAGGTAGGAGG - Intronic
1197455184 X:126670432-126670454 TAGAGACAGGAGAGAGCTGGGGG + Intergenic
1199209822 X:145194840-145194862 TAGAGACAGGAGAGGCCAGTAGG - Intergenic
1199775671 X:151009253-151009275 CGGTGGCAGGAGACAGCAGGAGG - Intergenic
1199800946 X:151250187-151250209 CAGTCTCAGGAGAGAGCTGGAGG - Intergenic
1200430372 Y:3072817-3072839 CAGTGACAGGTGAAGCCAGCTGG + Intergenic
1201499854 Y:14630003-14630025 CAATGACAGGTGAAGGGAGGAGG - Intronic
1201772790 Y:17632925-17632947 CAATGACACCTGAGGGCAGGTGG - Intergenic
1201828765 Y:18273062-18273084 CAATGACACCTGAGGGCAGGTGG + Intergenic
1201864760 Y:18637886-18637908 CAGTTATAGGAGAAGGCTGGAGG - Intergenic
1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG + Intergenic