ID: 999176220

View in Genome Browser
Species Human (GRCh38)
Location 5:149633371-149633393
Sequence CTGTAACCCAGGATCTACCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999176212_999176220 30 Left 999176212 5:149633318-149633340 CCCACGCCCATGCCTGTGGCAGC 0: 1
1: 0
2: 1
3: 17
4: 189
Right 999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 116
999176215_999176220 23 Left 999176215 5:149633325-149633347 CCATGCCTGTGGCAGCAAACCTT 0: 1
1: 0
2: 0
3: 19
4: 187
Right 999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 116
999176213_999176220 29 Left 999176213 5:149633319-149633341 CCACGCCCATGCCTGTGGCAGCA 0: 1
1: 0
2: 1
3: 24
4: 301
Right 999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 116
999176214_999176220 24 Left 999176214 5:149633324-149633346 CCCATGCCTGTGGCAGCAAACCT 0: 1
1: 0
2: 0
3: 14
4: 214
Right 999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 116
999176217_999176220 4 Left 999176217 5:149633344-149633366 CCTTGTTCATCAGTATAGCTTTC 0: 1
1: 0
2: 0
3: 16
4: 175
Right 999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 116
999176216_999176220 18 Left 999176216 5:149633330-149633352 CCTGTGGCAGCAAACCTTGTTCA 0: 1
1: 0
2: 0
3: 9
4: 98
Right 999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG 0: 1
1: 0
2: 1
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999176220 Original CRISPR CTGTAACCCAGGATCTACCT TGG Exonic
900738862 1:4318199-4318221 CTGTCACCCAGGAAATTCCTAGG + Intergenic
900804569 1:4758915-4758937 CTGTAACCCAGCATCCAGCTCGG - Intronic
904403775 1:30273369-30273391 CTGTTCCTCAGGCTCTACCTGGG - Intergenic
904592423 1:31622420-31622442 CTGTGACCCAGGTCCTGCCTTGG + Intronic
905610697 1:39348539-39348561 CTGTAAAACAGGATCTTCATGGG - Intronic
909023128 1:70453804-70453826 TTGTATCTCAGGATCTATCTGGG + Intergenic
919623717 1:199890698-199890720 CTGTCACCCAGGCTCAATCTCGG - Intergenic
919652339 1:200162778-200162800 CCGTTACCCAATATCTACCTGGG - Intronic
920262403 1:204698165-204698187 CTACAACCCAGGAACAACCTAGG + Intergenic
922859104 1:228800310-228800332 CTGTAACCCATGGTCAACCTTGG + Intergenic
1063293555 10:4777477-4777499 CTGTCACCCAGGCTATAGCTGGG + Intergenic
1067366782 10:45638441-45638463 CTGTCACCCAGGCGCTATCTCGG - Intronic
1067724991 10:48763101-48763123 ATTTAAGCCAGGACCTACCTGGG + Intronic
1071281694 10:84109683-84109705 CTGTAACCAAGAATCTATATAGG - Intergenic
1072004264 10:91228058-91228080 CTGTCTCCTAGGATCTACATAGG + Intronic
1074011527 10:109486436-109486458 CTGGCACCCAGGATCTCCCTAGG + Intergenic
1075391744 10:122097297-122097319 CTGTCACCCAGGCTGTACCCAGG - Intronic
1076694388 10:132240105-132240127 CTGTAGCCCAGGCTCTGCCCTGG - Intronic
1081881386 11:46455846-46455868 CTGAAACCCAGGATTAATCTGGG + Intronic
1086173223 11:83859918-83859940 CTGTGGCCCAAGCTCTACCTTGG - Intronic
1088823047 11:113472906-113472928 CTCTCCCCCAGGATCTTCCTGGG - Intronic
1090782955 11:130023508-130023530 CTGTGACCCATGAACTCCCTTGG - Intergenic
1091524724 12:1287648-1287670 CTGAAACCCTGGCTCTTCCTGGG + Intronic
1094226079 12:28047828-28047850 CTGGAACCCAAGAGCTACCCAGG + Intergenic
1095384061 12:41629481-41629503 CTGTGACCCATGATTTATCTTGG + Intergenic
1103707897 12:122889066-122889088 CTGGCACCCAGGATGTGCCTGGG - Intronic
1107819597 13:44274232-44274254 CTGTGACCCAGAATCTACTCTGG - Intergenic
1108809225 13:54200771-54200793 CTCCAACCCAGGATCCACCTGGG - Intergenic
1113420669 13:110169638-110169660 CTGGAATCCAGGGTCTCCCTTGG + Exonic
1117705707 14:58465142-58465164 CAATTACCCAGGATCAACCTTGG - Intronic
1119965167 14:78906787-78906809 ATGTAAGCCTGAATCTACCTAGG - Intronic
1122272614 14:100575105-100575127 CTGAAACCCAGGGTCCTCCTGGG + Intronic
1122633746 14:103120515-103120537 CTGGAACTCAAGATCAACCTGGG - Intergenic
1202841849 14_GL000009v2_random:128368-128390 CTGTCACCCAGGATGGAGCTTGG - Intergenic
1202911238 14_GL000194v1_random:118600-118622 CTGTCACCCAGGATGGAGCTTGG - Intergenic
1123992463 15:25693822-25693844 CTGTAACCCAGGCTCAACAGCGG + Intronic
1124126299 15:26940799-26940821 CTCTAACTCAGGAGGTACCTCGG + Intronic
1126691201 15:51290123-51290145 CAGTTTCCCAGGAACTACCTGGG + Intronic
1128537131 15:68500071-68500093 TTGTACCCCAGGACCTACCATGG + Intergenic
1132143868 15:99415329-99415351 CTGCAGCCCAGGCTCCACCTCGG + Intergenic
1140415719 16:74772731-74772753 CAGTAACCCACGGTCAACCTGGG + Intronic
1144834259 17:18148685-18148707 TTATAACCCAGGATCTCCCCAGG + Intronic
1145303146 17:21654495-21654517 CTGAAGTCCAGTATCTACCTGGG - Intergenic
1145346892 17:22047346-22047368 CTGAAGTCCAGTATCTACCTGGG + Intergenic
1145992528 17:29087706-29087728 TTGTAATCCTGGTTCTACCTCGG + Intronic
1148915802 17:50977539-50977561 CTGTGACACAGGATTTACTTAGG + Intronic
1150856880 17:68761594-68761616 CTTGAACCCAGGAGCTACCCAGG - Intergenic
1155301348 18:24432343-24432365 CTGTAATCCAGGATCTAGTAAGG + Intronic
1156179643 18:34587879-34587901 CTGTATCCCAGGAAATCCCTCGG + Intronic
1158945545 18:62444209-62444231 CCGAAACCCAGGATCTAACCAGG + Intergenic
1161228957 19:3163014-3163036 CTGTGACCCAGGCCCCACCTGGG + Exonic
1161575056 19:5050500-5050522 CTGTATTCCAGGGTCTTCCTGGG + Intronic
1162004325 19:7767624-7767646 CTTTCTCCCAGAATCTACCTGGG - Exonic
1163056815 19:14726155-14726177 CTGCAACCCAAGCTATACCTGGG + Intronic
1164848133 19:31451986-31452008 CAGTTACCCAGGGTCAACCTTGG - Intergenic
1167982825 19:53290201-53290223 CTGTTCCCAAGGATCTTCCTTGG + Exonic
1168725969 19:58582198-58582220 CTGTCACCCAGGCTGTACCCAGG - Intergenic
925340542 2:3132568-3132590 GTGGAATCCAGGATCTGCCTGGG - Intergenic
925474577 2:4198507-4198529 CTCAAACCCAGGACCTTCCTGGG - Intergenic
932756443 2:74413233-74413255 TTGTATCCCAGGACCTAGCTCGG - Intergenic
935706880 2:105864640-105864662 ATGTAATCCAGGGCCTACCTCGG + Intronic
940534339 2:154920448-154920470 CTGTCACCCACCATCTACTTGGG + Intergenic
948525380 2:238567860-238567882 CTGTATCCCAGGTTCTTCCTTGG - Intergenic
1173431340 20:42989524-42989546 CTGTTCCCCTGGTTCTACCTGGG - Intronic
1173480878 20:43398352-43398374 CTGTCACCCAGGTTCTAGCCTGG - Intergenic
1176043429 20:63080215-63080237 CTGTAACCAAGGACCAAACTAGG - Intergenic
1176630594 21:9133297-9133319 CTGTCACCCAGGATGGAGCTTGG - Intergenic
1177408563 21:20701397-20701419 CTGTAACACAGGACCTACTGTGG - Intergenic
1182437267 22:30338768-30338790 CAGTAAGCCAGCATCTACCCTGG - Exonic
1183018897 22:35011522-35011544 CTGTAAGCGAGGTTCTTCCTGGG - Intergenic
949693511 3:6667646-6667668 CTGTAGCCCAGGTTGTACCCAGG - Intergenic
950665704 3:14493609-14493631 CTGGGAGCCAGGATCTGCCTGGG + Exonic
955406418 3:58628425-58628447 CTGTGACCCAGAAACTACCAGGG - Intergenic
956109794 3:65859249-65859271 CTTGAACCCAGGAGGTACCTGGG + Intronic
956635244 3:71357541-71357563 CTAGAACCCAGAATTTACCTGGG + Intronic
956868823 3:73396354-73396376 CTGCAAACCAGGACCTACCTCGG - Intronic
956890998 3:73613879-73613901 ATGCAACACAGGATCTCCCTGGG + Intronic
959806538 3:110561683-110561705 CGGCATCTCAGGATCTACCTGGG - Intergenic
961269688 3:125679885-125679907 CTGGAGTCCAGCATCTACCTGGG - Intergenic
965587331 3:170330546-170330568 CAGCTACCCTGGATCTACCTTGG - Intergenic
967185915 3:186944432-186944454 CTCTAACCCAGGAATTATCTTGG - Intronic
977530392 4:98193935-98193957 CTGTAAGCCAGGAAATGCCTGGG + Intergenic
981823318 4:148911325-148911347 AGGTGACCCAGGATGTACCTTGG - Intergenic
983127248 4:163968968-163968990 CTGTAATCCAGGATATTTCTAGG - Intronic
987610665 5:20198855-20198877 CAATAACCCAGGCTATACCTTGG - Intronic
995174367 5:109157819-109157841 CTGTATAGCAGCATCTACCTCGG + Intronic
997327620 5:133035152-133035174 TTGTAACCCAGGTGTTACCTAGG + Intergenic
997999186 5:138610669-138610691 TTCTGACCCAGGATCTAGCTTGG + Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999176220 5:149633371-149633393 CTGTAACCCAGGATCTACCTTGG + Exonic
1001411679 5:171516723-171516745 CTGTATCCCAGCATCCAGCTTGG + Intergenic
1001837607 5:174845155-174845177 CTGTAACCCAGGTGATCCCTTGG + Intergenic
1003937994 6:10995448-10995470 CTTGAACCCAGGATCTCCCATGG + Intronic
1004321887 6:14638177-14638199 CTGAATCCCTGGATATACCTGGG + Intergenic
1005906688 6:30267353-30267375 TTGTATTCCAGCATCTACCTCGG + Intergenic
1007923767 6:45634511-45634533 CTTTAAAGCAGGATCTTCCTGGG + Intronic
1010072699 6:71762464-71762486 TTGTAACCCAGGAGCTCCCTTGG - Intergenic
1011590464 6:88965954-88965976 CTGAATCCCAGGTTCCACCTAGG - Intergenic
1012857281 6:104517378-104517400 CTGTGACCCAGGCTCTTCTTAGG - Intergenic
1021791622 7:24211726-24211748 AGGTTACCCAGGCTCTACCTGGG + Intergenic
1022834134 7:34097648-34097670 CTGAACCCCAGCATCAACCTGGG - Intronic
1025281150 7:57627149-57627171 CTGAAGTCCAGTATCTACCTGGG - Intergenic
1025303579 7:57838358-57838380 CTGAAGTCCAGTATCTACCTGGG + Intergenic
1026040920 7:66867252-66867274 CAGTAAACAAGGTTCTACCTGGG + Intergenic
1026064949 7:67062528-67062550 CTGTCACCCAGGCTATATCTGGG - Intronic
1031411985 7:121450205-121450227 CTGTAACCTCAGAACTACCTTGG - Intergenic
1034215230 7:149400494-149400516 CTGTAACCCAGCATGTACCTCGG - Intergenic
1034284227 7:149873875-149873897 CTGTCACTCAGGACCTGCCTAGG - Exonic
1035988804 8:4464990-4465012 CCTGAACCCAGGAGCTACCTTGG + Intronic
1038426664 8:27468378-27468400 CTGTAACCCAGGAGCTATCAGGG - Intronic
1039042817 8:33424306-33424328 CTGTAACACAGAAGCTACTTAGG + Intronic
1039491242 8:37949031-37949053 CTGTAACCCAGAATCTAACAAGG + Intergenic
1044432370 8:92123491-92123513 CTGAAATCCAGGACCTACCAAGG - Intergenic
1049193753 8:141304165-141304187 CTATAACCCAGCAGCTACTTGGG + Intronic
1054250333 9:62711062-62711084 CTGCAAACCAGGATATGCCTAGG - Intergenic
1054564441 9:66745590-66745612 CTGCAAACCAGGATATGCCTAGG - Intergenic
1057378508 9:94545985-94546007 CTGTCACCCATCATCTACCTGGG - Intergenic
1058108596 9:101004067-101004089 CTGTTCCCCAGGATCTCCTTTGG - Intergenic
1060296115 9:122344004-122344026 CTGTACCCCAGCATCTAGCCTGG + Intergenic
1062050929 9:134446699-134446721 CCGTAGCCCAGGTTCTTCCTGGG + Intergenic
1062163138 9:135090741-135090763 CTGTCACCCAGCAGCTACCTTGG + Intronic
1203753421 Un_GL000218v1:100982-101004 CTGTCACCCAGGATGGAGCTTGG - Intergenic
1186500242 X:10045037-10045059 CTGTCTCCCAGGACCTAGCTGGG - Intronic
1186694691 X:12017845-12017867 ATTTAACCCAGGTTCTAGCTTGG + Intergenic
1187482045 X:19666402-19666424 CTGAAACCAAGTAACTACCTGGG + Intronic
1192189793 X:68983778-68983800 CTGTTGCCCAGAATATACCTAGG - Intergenic
1192435525 X:71141366-71141388 CTGTAGTCCAGCAGCTACCTGGG - Exonic
1192470033 X:71390554-71390576 CTGTTACCCAGGCTGTACCGTGG + Intronic
1201167066 Y:11218548-11218570 CTGTCACCCAGGATGGAGCTTGG - Intergenic