ID: 999180267

View in Genome Browser
Species Human (GRCh38)
Location 5:149665229-149665251
Sequence CAGGCTTGGTCCTTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999180267_999180278 4 Left 999180267 5:149665229-149665251 CCCCTTCCCAAGGACCAAGCCTG No data
Right 999180278 5:149665256-149665278 GGCTGCAGCAGAACTGAAAACGG No data
999180267_999180279 13 Left 999180267 5:149665229-149665251 CCCCTTCCCAAGGACCAAGCCTG No data
Right 999180279 5:149665265-149665287 AGAACTGAAAACGGATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999180267 Original CRISPR CAGGCTTGGTCCTTGGGAAG GGG (reversed) Intergenic
No off target data available for this crispr