ID: 999185524

View in Genome Browser
Species Human (GRCh38)
Location 5:149704871-149704893
Sequence TAAAGTAGTAAAACTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999185524_999185529 26 Left 999185524 5:149704871-149704893 CCTGAAACAGTTTTACTACTTTA No data
Right 999185529 5:149704920-149704942 ATGTAAATTATCTAACTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999185524 Original CRISPR TAAAGTAGTAAAACTGTTTC AGG (reversed) Intergenic
No off target data available for this crispr