ID: 999185980

View in Genome Browser
Species Human (GRCh38)
Location 5:149709317-149709339
Sequence GTACAGCCAGGGCCAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999185972_999185980 18 Left 999185972 5:149709276-149709298 CCTAACTTGTGGCTGGGTGATCT No data
Right 999185980 5:149709317-149709339 GTACAGCCAGGGCCAGAATGAGG No data
999185968_999185980 30 Left 999185968 5:149709264-149709286 CCTTTGACATCACCTAACTTGTG No data
Right 999185980 5:149709317-149709339 GTACAGCCAGGGCCAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999185980 Original CRISPR GTACAGCCAGGGCCAGAATG AGG Intergenic
No off target data available for this crispr