ID: 999187757

View in Genome Browser
Species Human (GRCh38)
Location 5:149725417-149725439
Sequence CTGTGGTTCTCAGACTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999187757_999187760 17 Left 999187757 5:149725417-149725439 CCTCCAGAGTCTGAGAACCACAG No data
Right 999187760 5:149725457-149725479 ATAAAGCATCATCTTATTATTGG No data
999187757_999187761 22 Left 999187757 5:149725417-149725439 CCTCCAGAGTCTGAGAACCACAG No data
Right 999187761 5:149725462-149725484 GCATCATCTTATTATTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999187757 Original CRISPR CTGTGGTTCTCAGACTCTGG AGG (reversed) Intergenic
No off target data available for this crispr