ID: 999188914

View in Genome Browser
Species Human (GRCh38)
Location 5:149731917-149731939
Sequence CCGCGGGGCCGCGTGGTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999188900_999188914 12 Left 999188900 5:149731882-149731904 CCCTGGCCCGCTGCAGACGCCGC No data
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
999188903_999188914 5 Left 999188903 5:149731889-149731911 CCGCTGCAGACGCCGCTGCGTAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
999188901_999188914 11 Left 999188901 5:149731883-149731905 CCTGGCCCGCTGCAGACGCCGCT 0: 1
1: 0
2: 3
3: 29
4: 215
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
999188898_999188914 16 Left 999188898 5:149731878-149731900 CCGCCCCTGGCCCGCTGCAGACG No data
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
999188908_999188914 -7 Left 999188908 5:149731901-149731923 CCGCTGCGTAGGGGAGCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 84
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
999188902_999188914 6 Left 999188902 5:149731888-149731910 CCCGCTGCAGACGCCGCTGCGTA No data
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156
999188899_999188914 13 Left 999188899 5:149731881-149731903 CCCCTGGCCCGCTGCAGACGCCG 0: 1
1: 0
2: 2
3: 7
4: 129
Right 999188914 5:149731917-149731939 CCGCGGGGCCGCGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999188914 Original CRISPR CCGCGGGGCCGCGTGGTCGG TGG Intronic