ID: 999191221

View in Genome Browser
Species Human (GRCh38)
Location 5:149748871-149748893
Sequence GCTGCTCTGCAGAAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 433}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999191217_999191221 -5 Left 999191217 5:149748853-149748875 CCGAGAAACTAGCTGGAGGCTGC 0: 1
1: 0
2: 2
3: 14
4: 173
Right 999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG 0: 1
1: 0
2: 2
3: 38
4: 433
999191214_999191221 8 Left 999191214 5:149748840-149748862 CCAAGATTCTCGTCCGAGAAACT 0: 1
1: 0
2: 0
3: 3
4: 53
Right 999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG 0: 1
1: 0
2: 2
3: 38
4: 433
999191213_999191221 22 Left 999191213 5:149748826-149748848 CCAAAGATGGAACACCAAGATTC 0: 1
1: 0
2: 0
3: 29
4: 247
Right 999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG 0: 1
1: 0
2: 2
3: 38
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999191221 Original CRISPR GCTGCTCTGCAGAAGGGGAA AGG Intronic
900210894 1:1455446-1455468 GCTGACCTGCTGGAGGGGAAGGG - Exonic
900216717 1:1485765-1485787 GCTGACCTGCCGGAGGGGAAGGG - Exonic
900223799 1:1523494-1523516 GCTGACCTGCCGGAGGGGAAGGG - Exonic
900322589 1:2092457-2092479 GTTGCTCTGAAAAAGGGGGAGGG - Intronic
900462336 1:2807681-2807703 GCTGTTCTGCAGGTGGGGGAGGG - Intergenic
901762860 1:11481800-11481822 GGTGCTCTAAGGAAGGGGAAAGG - Intronic
902219171 1:14953993-14954015 GATGGGCTGCAGAAGGGCAAGGG + Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
903897121 1:26614345-26614367 GCTGCCCTGGAGAGGGGGCAGGG + Intergenic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
905452909 1:38068501-38068523 GCTGCTCTACTGAGGGGGGAGGG - Intergenic
905651182 1:39658044-39658066 GCAGCTCTGCTGGTGGGGAACGG - Intergenic
905688921 1:39928437-39928459 GCTGCACAGCAGAAGGTGAGTGG + Intergenic
905707567 1:40073057-40073079 GTTGATCTCCAGAAGGAGAAAGG + Exonic
905811480 1:40916575-40916597 GCTGCTCTGCTCATGGGGCATGG + Intergenic
906724944 1:48037317-48037339 GAGGCCCTGCAGAATGGGAATGG + Intergenic
907044699 1:51293502-51293524 ACTGCTCTGTAAAATGGGAAAGG + Intronic
907283140 1:53363607-53363629 GGTGCACTCCAGATGGGGAATGG - Intergenic
907478636 1:54726972-54726994 GCTTCTCTGCAGAAATGGACAGG + Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
909622337 1:77682847-77682869 GCTTTTCTGTACAAGGGGAAAGG - Intronic
911275530 1:95853679-95853701 GCTGCTGTGCAGAAGGGGGCAGG + Intergenic
912183249 1:107243724-107243746 GCTGCTCTAGAGAGAGGGAAAGG + Intronic
912311418 1:108625034-108625056 GCTGCTTTGCAGAAGTTGCAGGG - Intronic
912434344 1:109649500-109649522 TCTGCTCTGCAGATGGAAAATGG + Intergenic
912936472 1:114007613-114007635 GCTGCCCTTCAGATGGGGCAGGG - Intergenic
915080373 1:153348010-153348032 GATGCTCTGCAGATTGAGAATGG - Intronic
915588398 1:156857551-156857573 TCTGCTGTGCAGAAGAGGAGGGG + Intronic
917299200 1:173555297-173555319 GATGCTGTGCGGAAGGAGAAAGG + Intronic
919993356 1:202725048-202725070 GCTGCATTGCAGTAGAGGAATGG - Exonic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
920336533 1:205248943-205248965 GCCACACTGCAGGAGGGGAAGGG - Intronic
920353077 1:205350524-205350546 GCAGCTCTGCAGAGGAGAAAAGG + Intronic
920915313 1:210253787-210253809 GCTTTTCTGCAGAGGGGGCAGGG + Intergenic
921241430 1:213188043-213188065 GCTGCTCAGCAGAAGAGGTATGG - Intronic
921353113 1:214257845-214257867 GCTGCTGTGCAGCAGGGGTCGGG - Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923785084 1:237058781-237058803 GCTGGTCTGGAGAAGGGGCGGGG + Intronic
923791623 1:237116182-237116204 CTTGTTTTGCAGAAGGGGAAGGG + Intronic
924362238 1:243254599-243254621 GCTGCGCTGCCGCTGGGGAAGGG - Intronic
924496608 1:244596361-244596383 GCTGCTCTGTAGACGGAGCAGGG - Intronic
1063464822 10:6236308-6236330 GCATCTCTGCAGATGGGGCAGGG + Intergenic
1064104356 10:12488903-12488925 GCTGCACAGCAGGAGGGGGACGG - Intronic
1064531554 10:16315485-16315507 GCTGCTCTGCAAAGGGCTAAAGG - Intergenic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1067565258 10:47331594-47331616 GCTCCTCTGCAGATGAGGAAGGG + Intergenic
1067775371 10:49161122-49161144 GCCGGTCTACAGAAGGGGACAGG - Intronic
1067787951 10:49264596-49264618 GCTGCTGTGAAGCAGGGGATGGG - Intergenic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1069844955 10:71364614-71364636 GCTTCTCTGCAGAAGCGCACTGG + Intergenic
1070339909 10:75488501-75488523 ACTCCTCTGCACAAAGGGAAGGG - Intronic
1070550630 10:77488291-77488313 GCTGCTCTGGGGAAGGGGGATGG + Intronic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1072014044 10:91328301-91328323 GGTGCTAAGCAGAAGGGGGAGGG - Intergenic
1073143605 10:101264809-101264831 GCAGCTCCCCAGAAGGGGAGGGG + Intergenic
1073303635 10:102486099-102486121 GCTGCACAGCAGGAGGTGAATGG + Intronic
1075301838 10:121331665-121331687 GCTGCTCTGCTCAAGGGGACAGG - Intergenic
1075311668 10:121419578-121419600 GCTGCTCTACAGAGGGGTCAAGG + Intergenic
1075548352 10:123373224-123373246 GCTGCTCTGAACCAAGGGAATGG - Intergenic
1075674392 10:124286344-124286366 CCTGCCCTGCAGGAAGGGAACGG + Intergenic
1075982033 10:126748361-126748383 TCTGGTCTGCAGGTGGGGAATGG - Intergenic
1076404090 10:130201018-130201040 CCTGTTCTGCAGGAGGGGAGAGG + Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1077393492 11:2310318-2310340 CCTGCTCTCCAGGAAGGGAAGGG + Intronic
1077463083 11:2720692-2720714 GCCGCCCTGCAAAAGGGGGAAGG - Intronic
1077528493 11:3083566-3083588 CCTGCTCAGCAGAAGAGAAAAGG + Intergenic
1079259424 11:18864039-18864061 GATGCTCTGCAGCAGGGACAGGG + Intergenic
1079285046 11:19121341-19121363 TCTGCTCTGAAAATGGGGAAGGG + Intronic
1079314708 11:19397869-19397891 GCTGGGCTGCAGTAGGGGAGGGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081540643 11:44032287-44032309 GCTGCTCTGCAGCATGGCACTGG + Intergenic
1081643447 11:44774018-44774040 GCTACACTGCTGAAAGGGAAAGG - Intronic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1081736835 11:45410298-45410320 GTTGCTCTGAGGAAAGGGAAGGG - Intergenic
1082009047 11:47438155-47438177 GCTGTTCAGCAGCAGTGGAAGGG + Intronic
1082901368 11:58256579-58256601 GATGGTCTGCTGCAGGGGAAAGG + Intergenic
1083572093 11:63766299-63766321 CTTGCCCTGAAGAAGGGGAAAGG + Exonic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1084316240 11:68347485-68347507 GCTTCTCTGCAGAACAGGACAGG + Intronic
1084366397 11:68703634-68703656 GATGTTCTTCAGGAGGGGAAGGG + Intergenic
1086244832 11:84740173-84740195 GCTGCAGTACAGCAGGGGAATGG + Intronic
1087454880 11:98372353-98372375 GCTGCACAGCAGAAGGTGAGGGG - Intergenic
1089086085 11:115818022-115818044 CCTCCTCTGGAGCAGGGGAAGGG + Intergenic
1090234217 11:125134604-125134626 GGTGCTCTTCACCAGGGGAATGG - Intergenic
1090238874 11:125167545-125167567 GCTGCTCAGAATAAGGGGCAGGG + Intronic
1090412464 11:126518725-126518747 CCTGGTCTGGGGAAGGGGAATGG - Intronic
1090618990 11:128544549-128544571 GCTGCTCTGGAGACGGGGAGAGG - Intronic
1090673688 11:128969871-128969893 CGTGCTCGGCAGAAGGTGAAAGG - Exonic
1091104848 11:132909016-132909038 GCTCCTCCTCAGAAGGGCAAGGG + Intronic
1091374914 12:18853-18875 TCGCCTCTGCAGAGGGGGAATGG + Intergenic
1092165785 12:6341563-6341585 GCTGCGCTGAGGCAGGGGAATGG - Intronic
1094157706 12:27354860-27354882 GGTGCCTTACAGAAGGGGAAGGG - Intronic
1094484188 12:30911342-30911364 ACGGCTCTGCAGAATTGGAAAGG - Intergenic
1095398274 12:41786132-41786154 GATACTCTGCAGAATGTGAAAGG - Intergenic
1095862088 12:46928733-46928755 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1095947098 12:47759470-47759492 ACTGCTCTCCAGAACGGGTAGGG + Intronic
1096240295 12:49956203-49956225 CCTCCTCAGGAGAAGGGGAAGGG + Exonic
1096581195 12:52586467-52586489 GCTGGTCTGCTGATGAGGAAAGG + Intronic
1096587490 12:52632263-52632285 GCTCCTATGCAGCAGGGCAAGGG + Intergenic
1096677643 12:53234133-53234155 GCCCCTCTACAGAAGGAGAAGGG - Intergenic
1096928361 12:55174160-55174182 GATGCTCTTCAGTAGGTGAATGG - Intergenic
1098061458 12:66567710-66567732 TCTGCTCAACTGAAGGGGAATGG - Intronic
1098157271 12:67612611-67612633 GCCGCACAGCAGAAGGTGAATGG + Intergenic
1098899894 12:76101904-76101926 TCTGCTTTGCTGTAGGGGAAGGG - Intergenic
1100136132 12:91555852-91555874 GCTGCTCTGCAAAAGGTGGGAGG + Intergenic
1100760083 12:97797588-97797610 GGTGCCTGGCAGAAGGGGAATGG + Intergenic
1101869172 12:108548526-108548548 TATGCTTTGCAGAAGGGAAAAGG + Intronic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1102588551 12:113940346-113940368 GCAGCTCTGCAGAGGGGGTAAGG + Intronic
1103889835 12:124230100-124230122 GCTGGTCTGCTGGAGGGTAAGGG + Intronic
1104145696 12:126031668-126031690 GCTGCTATGCTGTAGGGGAGGGG + Intergenic
1104383080 12:128325083-128325105 GATACTCTGCAGAAGGGCAGCGG + Intronic
1104444387 12:128822189-128822211 GCAGCTCTTCAGGAGGGGCAAGG - Intronic
1104567982 12:129902724-129902746 GCGGCTCTGAAGAAGGGGGATGG - Intronic
1105793799 13:23831033-23831055 GCTACTGTGAAGCAGGGGAAAGG + Intronic
1105856324 13:24375792-24375814 GCTGCTTAGCAGACCGGGAAAGG + Intergenic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1108562924 13:51664459-51664481 GCTGATCTGCAGAAAAGGTAGGG + Intronic
1109968326 13:69731460-69731482 GCTGCTGTGTAGAAGTGAAAAGG - Intronic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1113985322 13:114310334-114310356 GCTGCTCTGCCTGAGAGGAAAGG + Intergenic
1114049233 14:18907375-18907397 GCCTCTCTCCAGAAGGGAAAAGG - Intergenic
1114113331 14:19494556-19494578 GCCTCTCTCCAGAAGGGAAAAGG + Intergenic
1114115034 14:19612310-19612332 GCCTCTCTCCAGAAGGGAAAAGG + Intergenic
1114237290 14:20834229-20834251 GGTCCTCTGCAGAGGGGGCATGG + Intergenic
1115260208 14:31444429-31444451 GATGGTCTGCAGAAAAGGAATGG + Intronic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1118941895 14:70346463-70346485 GGTCCTCTGCAGAGGGGGCATGG - Intronic
1119585622 14:75832227-75832249 GCTGCTATGCTGGAGGAGAAGGG + Intronic
1119643898 14:76334879-76334901 GCTGGTCTGCAGCAGGGACAGGG + Intronic
1121685890 14:95834760-95834782 GCTGCTTTCCAGGAGGGAAATGG - Intergenic
1122267097 14:100551818-100551840 GCTGCTCTGCAGAAGTGGGCGGG + Intronic
1122357770 14:101134290-101134312 GCTGCACTGCAGACGGGGTTGGG - Intergenic
1122401623 14:101470752-101470774 GGTGCTCTGCAGAGGGGCATGGG - Intergenic
1122756021 14:103980692-103980714 GCTACTCAGCAGACCGGGAAAGG - Intronic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1124675962 15:31686142-31686164 GCTGCTATGCAGAAGGGAACAGG + Intronic
1126334176 15:47568519-47568541 GTTCCTCTGCAGAAAAGGAAAGG + Intronic
1128280048 15:66387091-66387113 GCTGCCCTGCAGGAGCGGAGCGG - Exonic
1128306381 15:66601473-66601495 GCTGCTCTGCTGATGGGGTGGGG + Intronic
1128732351 15:70029751-70029773 ACTGCTTGGCAGAAGGTGAAAGG + Intergenic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1129237202 15:74230812-74230834 CCTGCTCTGCAGATGAGGAATGG + Intergenic
1130301160 15:82680579-82680601 GCGGCTCTGCAGCAGGGGTTTGG + Exonic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1131311239 15:91292352-91292374 GTTGCTCTGTAAAAGAGGAATGG - Exonic
1131523834 15:93137042-93137064 GCTGCACTGATGAAGGTGAAAGG + Intergenic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1131967358 15:97858622-97858644 GTGGCTCAGCAGAAGGTGAAAGG - Intergenic
1132825445 16:1902925-1902947 GCAGCTGTGCAGCAGGGGAGGGG - Intergenic
1132831223 16:1929463-1929485 GCTGCCCTGAAGAAGGGGCTGGG + Intergenic
1132904333 16:2274465-2274487 GATGCCCTGCAGAAGGGCCATGG + Intergenic
1133230022 16:4361999-4362021 GCTGCTCAGCAGCGGGGGACAGG - Exonic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1135433667 16:22409489-22409511 GATGCTCTTCAGTAGGTGAATGG - Intronic
1137275188 16:46928855-46928877 GCTGCTCTGCAAGATGGGAGAGG - Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1137625263 16:49903645-49903667 GCTGGCCTGCTGAAGAGGAAGGG - Intergenic
1138336787 16:56259678-56259700 AGTGGTCTGCAGAAGGGGCAGGG + Intronic
1138446843 16:57070028-57070050 GCTGCACTTCATCAGGGGAAGGG - Intronic
1138905638 16:61328018-61328040 GCTGCTATGGAGAAGAGTAACGG - Intergenic
1139122192 16:64033936-64033958 GCTGCACAGCAGAAGATGAATGG - Intergenic
1139590143 16:67928822-67928844 GAAGCTCAGCAGAAGGGGAGAGG - Exonic
1139961714 16:70721778-70721800 GCTGCTCTGCAGACAGGGTTAGG + Intronic
1140132848 16:72179176-72179198 CCTGCTCTCCAGCAGGAGAAGGG + Intergenic
1140457487 16:75113657-75113679 TCTCCTCTGCAGTTGGGGAAGGG + Exonic
1140575029 16:76157844-76157866 TCAGCTCTGCAGCAGGGCAAAGG + Intergenic
1140641927 16:76984887-76984909 GCTGCTCTGGAGAAGGGAAGGGG + Intergenic
1140948845 16:79796627-79796649 GTCTCTCTGCAGAAGGGAAAAGG + Intergenic
1141002135 16:80317974-80317996 GAGGCACTGCAGAAGAGGAAGGG + Intergenic
1141328873 16:83089579-83089601 CCTGCTCTGGAGGTGGGGAATGG + Intronic
1142102843 16:88284767-88284789 GCAGCTCTGCAGGAGGGCGATGG + Intergenic
1143039735 17:4025000-4025022 GCTGCTTTGCAGAAGGTGACTGG + Exonic
1143082781 17:4394044-4394066 GCAGATTTGCAGCAGGGGAATGG + Intergenic
1143255122 17:5551421-5551443 GCTGCCCTTCAGAAAGTGAATGG - Intronic
1143323229 17:6081205-6081227 TCTGCTCTGCAGGACAGGAAGGG + Intronic
1143610083 17:8013086-8013108 GCTGGTCTGGGGATGGGGAAGGG - Exonic
1143683164 17:8492506-8492528 ACAGCTGTGCAGAAGGGGATGGG + Exonic
1143852590 17:9823861-9823883 GGTGCTGTGCAGAATGGGGAGGG + Intronic
1144290361 17:13820518-13820540 GCTACTCTGCAGAAGGACACTGG + Intergenic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1147229860 17:39009675-39009697 GCTCCTCTGCAGAAAGTGATGGG - Intergenic
1147645952 17:42034007-42034029 ACAGCTGGGCAGAAGGGGAAGGG + Intronic
1148046872 17:44749764-44749786 GCGGCTCTGCAGAGAGGCAAGGG - Intronic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151623741 17:75263378-75263400 GTTCCTCTGCAGAAGCGGCATGG - Exonic
1152104775 17:78322645-78322667 GCTGCTCCACAGAAGGGCAGGGG - Intergenic
1152287679 17:79422161-79422183 GCTGCTCTGGAGAGGCAGAAGGG + Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153118670 18:1692821-1692843 GCTGTTCAGTAGAAGTGGAAAGG + Intergenic
1153618534 18:6955123-6955145 GCCACTCTCCAGAAGGGAAAAGG + Intronic
1153881486 18:9425328-9425350 GCTGCTTTGTAGAAGGGGTTGGG + Intergenic
1154164440 18:12003889-12003911 GCTGCTCCACAGAAGGGACAAGG - Intronic
1157289508 18:46399752-46399774 TCTGCTCTGAAGAAAGGGCAGGG - Intronic
1157780249 18:50431990-50432012 GCTGCACAGCAGGAGGTGAACGG + Intergenic
1158181055 18:54715254-54715276 GCTGGACTGCAGAAGGGGAGTGG - Intergenic
1159937722 18:74382335-74382357 TCTGCTCTGCGGGAGGAGAAGGG - Intergenic
1160063548 18:75553298-75553320 GCAGGTCTTCAGAAGGAGAAAGG + Intergenic
1160471987 18:79144589-79144611 GCTGCACAGCAGGAGGGGAGGGG - Intronic
1161054716 19:2184561-2184583 GCGGCTCTGCAGGAGGGGTCAGG - Intronic
1162286888 19:9745474-9745496 GTTGCTTTGCAGAAGGGGTTGGG - Intergenic
1164301874 19:23969855-23969877 GCTGCACAGCAGGAGGTGAATGG - Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1166437244 19:42777848-42777870 ACGGCCCTGCAGCAGGGGAAGGG + Intronic
1166446953 19:42866295-42866317 ACGGCCCTGCAGCAGGGGAAGGG + Intronic
1166456356 19:42943244-42943266 ACGGCCCTGCAGCAGGGGAAGGG + Intronic
1166466148 19:43032515-43032537 ACGGCCCTGCAGCAGGGGAAGGG + Intronic
1166472289 19:43088583-43088605 ACGGCCCTGCAGCAGGGGAAGGG + Intronic
1166483425 19:43192532-43192554 ACAGCCCTGCAGCAGGGGAAGGG + Intronic
1166485895 19:43211619-43211641 ACGGCCCTGCAGCAGGGGAAGGG + Intergenic
1166667479 19:44689644-44689666 GCTGCTCTGTGGTAGGAGAATGG - Intergenic
1167130368 19:47581541-47581563 GATGCTCTTCAGAAGGAGAGGGG + Intergenic
1167265089 19:48479106-48479128 GCCGCCCTGCAGAAGGGGAGGGG - Exonic
1167597623 19:50435792-50435814 GCTCCTCTGCAGTCGGGGACTGG - Exonic
1167746546 19:51354308-51354330 TCTGCCCAGCAGGAGGGGAAGGG + Exonic
1168322273 19:55517606-55517628 CCTGCTCTGAGGTAGGGGAAAGG - Exonic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
925439494 2:3872145-3872167 GCTGCACAGCAGAAGGTGAACGG - Intergenic
926068902 2:9868399-9868421 GATGCTTTGCTGACGGGGAAAGG - Exonic
926846999 2:17152403-17152425 GCCGCACTGCAGGAGGTGAATGG - Intergenic
926885041 2:17589417-17589439 GCAGCTGTGCAGAAGGAGAGTGG + Intronic
926893666 2:17660716-17660738 GCTGCTGTTCTGAAGGGAAAAGG + Intergenic
927321840 2:21756252-21756274 GCTGCACAGCAGAAGGCTAATGG + Intergenic
927905863 2:26855786-26855808 CTTGCTCTGCAGAAGGACAAAGG - Intronic
928130497 2:28645684-28645706 CCTTCTCTGTAGAAAGGGAATGG - Intergenic
928399063 2:30965015-30965037 GCTGCTCAGCAGGACAGGAAGGG + Intronic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930912008 2:56640510-56640532 GTTGCTATGCAGTGGGGGAAGGG - Intergenic
931784783 2:65609010-65609032 ACTGCTCTTCTGAAGTGGAAGGG + Intergenic
931879093 2:66547945-66547967 TCTGTTCTTCAGAAGGGTAAGGG - Exonic
932304296 2:70690968-70690990 GCTGCTCTGAGGAAAGGGCAGGG - Intronic
934735402 2:96687422-96687444 GCTGCTCTGTAGAATGGGCCTGG + Intergenic
934941558 2:98506757-98506779 GCTGCTCCTCACAAGAGGAAGGG + Intronic
935499264 2:103818432-103818454 GGTGCTGGGCAGGAGGGGAAAGG + Intergenic
935587980 2:104818660-104818682 GCTTCTATACAGAAAGGGAAAGG - Intergenic
936495861 2:113020368-113020390 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
937635449 2:124150890-124150912 GCTACTCTTCAGAAGGGACAGGG - Intronic
937968983 2:127535539-127535561 GCTGCTCTGCAGAAGGGGCCTGG + Intergenic
938182694 2:129197207-129197229 ACTTCTCTGAAGAAGTGGAATGG + Intergenic
938426574 2:131195702-131195724 GCCTCTCTCCAGAAGGGAAAAGG - Intronic
942338810 2:174921121-174921143 GCTGCACAGCAGGAGGTGAATGG - Intronic
942582406 2:177432829-177432851 CCAGTCCTGCAGAAGGGGAAGGG + Intronic
943502183 2:188705938-188705960 GCTGCTCAGCAGTAGGAGAGTGG + Intergenic
944206672 2:197164469-197164491 GCTGCTCTTCAGCTGGGGGAAGG - Intronic
945209063 2:207363777-207363799 TCTGCTCTGAAAAAGGGAAAAGG + Intergenic
945933998 2:215884657-215884679 GCAGCTCTGTGGAAGGGCAATGG + Intergenic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
947641064 2:231708135-231708157 GCTGCTCGGAAGGAGGGGGAGGG - Intronic
948166364 2:235865653-235865675 GGTGCTCTGGAGGAGGGGCAGGG + Intronic
948255519 2:236565836-236565858 GTTGCCCTGCAGAAGGGGCTTGG + Intergenic
948551570 2:238776157-238776179 GCTGCTCATGAGAAGGGGAGTGG + Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948690252 2:239697684-239697706 GCTGCACAGCAGAAGGCGAGAGG - Intergenic
1168983959 20:2031726-2031748 GCTGCTGTGCAGATGGCGAGGGG - Intergenic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1172777392 20:37415449-37415471 GCTGCACTGCAGGAGGTGACAGG - Intergenic
1173333917 20:42098013-42098035 GCTGCATTGCAGAGGGGGAAGGG + Intronic
1173862731 20:46294755-46294777 GCTACTCTGTAGAAGGGAAGAGG + Intronic
1174628364 20:51934949-51934971 GCTGCCCTGGAGTGGGGGAAGGG + Intergenic
1175211694 20:57361897-57361919 GCTGCACAGCAGGAGGTGAATGG + Intronic
1175860884 20:62149419-62149441 GCTGCTGTGCACAATGGGGACGG + Intronic
1176007413 20:62873941-62873963 GCTACTTAGCAGACGGGGAAAGG + Intergenic
1176155823 20:63619875-63619897 GCTGGTCTGTGGAACGGGAAGGG + Exonic
1176246469 20:64099584-64099606 GCTGGTCTCCTGAAGGGAAATGG - Exonic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178271337 21:31192821-31192843 GTCACTCTGCAGAGGGGGAAGGG - Intronic
1178628873 21:34242002-34242024 GATGCTCTTCAGTAGGTGAATGG + Intergenic
1179193179 21:39140692-39140714 TTTTCTCTGCAGATGGGGAAGGG - Intergenic
1179667553 21:42923123-42923145 GGTCCTCTGCAGAGGGGGCACGG + Intergenic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1180467712 22:15629749-15629771 GCCTCTCTCCAGAAGGGAAAAGG - Intergenic
1180699938 22:17775782-17775804 GGTGCCCTGCAGAAGACGAAAGG + Intergenic
1181179218 22:21055409-21055431 GCTGCTCTGCTGAAGGTGGCTGG + Intronic
1181638588 22:24185474-24185496 GCTGCTCTGCAGACGGACTACGG + Exonic
1181668472 22:24414279-24414301 ACGGCTCTGCAGGATGGGAAGGG - Intronic
1181851671 22:25754132-25754154 GCTGCTCTGGAGGAGGAGTAGGG + Intronic
1182745439 22:32602220-32602242 CCTGGTCTGGAGAAGGGGAGTGG - Intronic
1182960379 22:34466628-34466650 GCTGCTTTGAAGATGAGGAAGGG - Intergenic
1183346969 22:37313312-37313334 CCTGCTCTGCCGCGGGGGAAAGG - Intronic
1184226560 22:43132242-43132264 GCTGCTCTGAGGACGGGGCATGG + Exonic
949586867 3:5449304-5449326 GGAGCTGTGGAGAAGGGGAATGG + Intergenic
950020205 3:9781757-9781779 GCTGCTCTGCAGCAGGGTAAGGG + Intronic
950988174 3:17399599-17399621 GCTGCTGTGCAGTGGGGCAAAGG - Intronic
952243042 3:31553375-31553397 AATGCCCTTCAGAAGGGGAATGG + Intronic
953300319 3:41767968-41767990 GCTGCACAGCAGAAGGTGAGCGG + Intronic
953580010 3:44145232-44145254 GCTGCACAGCAGGAGGTGAAAGG + Intergenic
953976270 3:47383899-47383921 GGGGCTCTGCAGTTGGGGAAGGG - Intronic
954012890 3:47658436-47658458 GTTGCTCTGCATAAGCGGAATGG - Intronic
954135502 3:48580339-48580361 GCTGCCCTGCAGAAAGGCAGGGG + Exonic
954820883 3:53326511-53326533 GCTGCACAGCAGAAGGTGAGTGG + Intronic
955936729 3:64109541-64109563 GCTGCACTGGGGAAGGGAAAGGG + Intronic
957436214 3:80180249-80180271 GCTTCTCTACAGAAAGGAAAAGG + Intergenic
962254503 3:133861107-133861129 CCAGGCCTGCAGAAGGGGAAGGG + Intronic
963061136 3:141227912-141227934 GCTGCTCTCAGGAGGGGGAAGGG + Intergenic
963607279 3:147421855-147421877 GCTGGTCTCTAAAAGGGGAAAGG + Intronic
964264009 3:154873712-154873734 GCTGCACAGCAGCAGGTGAACGG + Intergenic
964876831 3:161376911-161376933 GCTGCACAGCAGGAGGTGAATGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968799261 4:2731581-2731603 GCTGCACTTGAGAAGGGGAAAGG - Intronic
968967101 4:3774281-3774303 GCCTCTCTGCAGAGTGGGAAGGG - Intergenic
969531487 4:7733258-7733280 GCTCCTCTGCCAAAAGGGAAGGG - Intronic
973145497 4:46820418-46820440 GCTGCACTGCAGGAGGTGAGAGG - Intronic
974062979 4:57052340-57052362 GCTGGATTGAAGAAGGGGAAAGG + Intronic
975846258 4:78528424-78528446 GGTTATCTGCAGAAAGGGAATGG - Intronic
976165266 4:82247802-82247824 GCTGCTCAGCAGGAGGTGAGTGG + Intergenic
976300047 4:83508367-83508389 GGTCCTCTGCAGAGGGGGCACGG + Intronic
978357627 4:107893632-107893654 GGGGCTCTGCAGAAGGACAAGGG + Intronic
978605599 4:110476089-110476111 GCTGCAGTGCAGGAGGGGTAGGG + Exonic
979199683 4:117962122-117962144 GCTTCCCAGCAGAAGGGAAAGGG + Intergenic
980054881 4:128069632-128069654 GCTGCTAGACAGAAGGGGCACGG + Intronic
981739325 4:147985594-147985616 TTTGCTCTGCAGCAGGGGAAAGG - Intronic
981870264 4:149477367-149477389 GCTGATATGCACAAGGGTAAGGG + Intergenic
982445640 4:155487624-155487646 GCTGCTGTACTGATGGGGAATGG + Intergenic
982809061 4:159803598-159803620 GCTGCACAGCAGAAGGGGTGTGG - Intergenic
983074817 4:163313294-163313316 GATGTTCTTCAGAAGGTGAATGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984630806 4:182058787-182058809 GTTGCCCTTCAGAAAGGGAAAGG - Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984863609 4:184261469-184261491 CTTCCTCTGCAGAAGAGGAAAGG - Intergenic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
985663292 5:1168139-1168161 GCTGCTCAGCACCAGGGGCAGGG - Intergenic
985712561 5:1437722-1437744 GCAGGTCTGCAGGAGGGGAAGGG + Intronic
986333047 5:6732021-6732043 GCTGCACTGCAGTAGGTAAAGGG - Intronic
986386352 5:7237846-7237868 GCTGCACCTCAGAAGTGGAAAGG + Intergenic
987317406 5:16736547-16736569 GGTCCTGTGCAGAAGTGGAAGGG - Intronic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
988674120 5:33413628-33413650 GCAGCTTTGCTGAAGGTGAAAGG + Intergenic
989585813 5:43073171-43073193 GGTCCTCTGCAGAGGGGGCATGG + Intronic
989718956 5:44502283-44502305 TCTGATCTGCAATAGGGGAAGGG - Intergenic
990612156 5:57468515-57468537 GCTGCACTGCAGGAGGTGATCGG - Intergenic
990726025 5:58755597-58755619 GCAGCACTGGAGGAGGGGAATGG + Intronic
991254504 5:64599454-64599476 GCAGCTCAGCAGAAGGTGGAGGG + Intronic
991540243 5:67719751-67719773 ACTGCCCTTCAGTAGGGGAATGG + Intergenic
992231276 5:74666611-74666633 GCTGCTCTGCAGTGTGGGCAGGG - Intronic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995837614 5:116414078-116414100 GCTGCAATGCACAAGGGGTAGGG + Intergenic
998169497 5:139864154-139864176 CCTGCTCTGCAGGATGGGATGGG + Intronic
998313582 5:141158133-141158155 GCGGCTGTGCAGAAGGAGCAGGG + Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999331718 5:150677989-150678011 GGTGTTCTGCAGAAGGGAGAAGG + Exonic
1000049954 5:157554309-157554331 GCTGCTCTTCAGCAGGAGCACGG - Intronic
1000203027 5:159030599-159030621 GCAGCCCTGCAGAAGGAGCAAGG + Intronic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1001894411 5:175365967-175365989 GCTGCACAGCAGAAAGTGAATGG + Intergenic
1002444165 5:179279036-179279058 GGTGCTCTGCAGAAGGAAACAGG - Intronic
1002761526 6:206067-206089 GCTGCTCTGCAGAAGTTCAGAGG - Intergenic
1002989850 6:2228498-2228520 GCTGCCCTGGGGATGGGGAAGGG - Intronic
1003366495 6:5479908-5479930 GCTCCTCAGGAGAAGGAGAAGGG + Intronic
1004258861 6:14089992-14090014 CCTGCTCCCCAGAAGGGCAAAGG - Intergenic
1007396126 6:41578820-41578842 GCTGCTGGGCAGAGGGGGAGGGG - Intronic
1007499072 6:42281601-42281623 GCTGGTCTGGAGAAGGGGATTGG - Intronic
1007780971 6:44254564-44254586 CCAGCTCTGCAGCAGGGGATTGG - Exonic
1009901420 6:69812037-69812059 GTTGCTTTGCAGCAGGAGAAAGG + Intergenic
1011344575 6:86354625-86354647 GCTTCTCTCCAGAAAAGGAAGGG + Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1012835143 6:104255084-104255106 TGTGCTCTGAAGAAGAGGAAAGG - Intergenic
1013589469 6:111608084-111608106 GCTACTTAGCAGACGGGGAAAGG + Intergenic
1013943044 6:115688858-115688880 ACTGTTTTGCAGAAGAGGAAGGG - Intergenic
1015618697 6:135106818-135106840 GCAGTTCTGGTGAAGGGGAAAGG + Intergenic
1015926053 6:138311500-138311522 GCTGCTCTCAGGTAGGGGAATGG + Exonic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017657597 6:156645136-156645158 TCTGCTCTGCAGAAGAACAAGGG + Intergenic
1018664720 6:166125197-166125219 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1019154725 6:170031314-170031336 GCTGCCCTGCTGAAAGGGAGGGG + Intergenic
1021615340 7:22498136-22498158 GCTGCACAGCAGGAGGGGAGTGG - Intronic
1021873105 7:25022844-25022866 GCTCCTCAGCACAAGGGAAAAGG + Intergenic
1022514680 7:30967985-30968007 GCTGGTCTGAAGATGGAGAAAGG - Intronic
1022991370 7:35711284-35711306 AGTTCTCTGCAGAAGGGGAAAGG + Intergenic
1023021817 7:36017903-36017925 GCTGCTTAGCAGACCGGGAAAGG - Intergenic
1023085813 7:36568960-36568982 GGTGGTCTGCACAAGGGGATGGG + Intronic
1023817499 7:43961890-43961912 TCTGCTCTGCAGAATGGGTTTGG + Intergenic
1024575682 7:50762211-50762233 GCTGCTGTGCAGAAGGGCTGGGG - Intronic
1024664109 7:51528904-51528926 GCTGCACTGTGGAAGGTGAAGGG - Intergenic
1024680344 7:51680505-51680527 GCTGCTCTGCACTAGGGGAGGGG + Intergenic
1024731219 7:52255935-52255957 GGTTCTCTGCAGCAGGTGAATGG + Intergenic
1026316027 7:69228431-69228453 GCTGCACAGCAGAAGGTGAGCGG - Intergenic
1028377155 7:90156496-90156518 GCTGCACAGCAGGAGGGGAGTGG + Intronic
1029275236 7:99400022-99400044 GGTGCTCTGGAAGAGGGGAATGG + Intronic
1029419893 7:100467059-100467081 GCTGCGCTGGAGCAGGAGAATGG - Exonic
1029528221 7:101108508-101108530 GCAGCTCTGCAGCAGGTGGAAGG - Intergenic
1029664328 7:101985254-101985276 GCTGCTCTGCAGACGGGAGAGGG + Intronic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032441630 7:131946624-131946646 GCCTCTCTGGAGAAGGGAAACGG + Intergenic
1032795607 7:135273782-135273804 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1032807749 7:135374154-135374176 GATGGGCAGCAGAAGGGGAAAGG - Intronic
1032903304 7:136335743-136335765 GCTGCACAGCAGGAGGTGAACGG + Intergenic
1033131563 7:138749792-138749814 GAGGCTCTGCTGAAGGGGCAGGG - Intronic
1034186831 7:149184548-149184570 GCTGCTCTGCAGAAGTATCATGG + Intergenic
1034980035 7:155469799-155469821 GCTGCTTAGGAGTAGGGGAAAGG + Intergenic
1034980412 7:155472237-155472259 GATGCTCTACAGAAGGGGACAGG - Intergenic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1035723003 8:1806416-1806438 GCTGCTTTGGAGGTGGGGAAGGG + Intergenic
1036549896 8:9806602-9806624 GTTGCTTTGCAGAAGGGGTTGGG - Intergenic
1036710650 8:11076452-11076474 GCTCCTCTGCTGATGGGGTAAGG - Intronic
1037510313 8:19575979-19576001 CCTGCTCTGCAGAAAGGAAGGGG - Intronic
1039953999 8:42193552-42193574 GCTGCTGGGGAAAAGGGGAATGG - Intronic
1040415734 8:47193852-47193874 GCTGCTCTCCATAAAGTGAAGGG + Intergenic
1041724667 8:61006793-61006815 GCAGCACTACAGAAGGGCAAAGG - Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1043765839 8:84131198-84131220 GCTTCTCTGAAGAGGGGAAATGG - Intergenic
1044459995 8:92432973-92432995 GCTGCTCTGCTAAAGAGGAAAGG + Intergenic
1045290076 8:100825467-100825489 GGGGCTCTCCAGAAGAGGAAGGG + Intergenic
1046161161 8:110366857-110366879 GCTGCTATGAAGAAGAAGAAAGG + Intergenic
1046720907 8:117618117-117618139 GCTGCTCTGGAGTAGGGTAGGGG - Intergenic
1047084212 8:121498381-121498403 GCTACTCGGGAGCAGGGGAATGG - Intergenic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049472614 8:142783123-142783145 GGCCCTCTCCAGAAGGGGAAGGG - Intergenic
1049626235 8:143623078-143623100 GCTGCTGTGCAGACAGGGATCGG - Intergenic
1050151031 9:2620014-2620036 ACTGCTTTACAGAAGAGGAAAGG - Intergenic
1050182310 9:2934375-2934397 GCTCCTGGGCAGAAGGGGACGGG + Intergenic
1050602308 9:7265361-7265383 GCTGCTATCCAAAAGGGAAAGGG - Intergenic
1050722672 9:8608572-8608594 GCTGCCCTGGAGCAGGGGATGGG - Intronic
1050992615 9:12172477-12172499 GCTCCTCTGCAGAGGTGGTAAGG + Intergenic
1051614060 9:18990633-18990655 GCTGCACAGCAGAAGGTGAGTGG + Intronic
1051730284 9:20134805-20134827 TCTGCTATGCAGAAATGGAAAGG + Intergenic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1054804746 9:69387036-69387058 GCAGGTCTGCAGAATGAGAAGGG - Intronic
1055088935 9:72343110-72343132 CCTGCTCTGAAGAAGGGCTAAGG - Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1055723199 9:79198531-79198553 GGAGCTCTGCAGAAGGATAAAGG - Intergenic
1056975283 9:91247262-91247284 GCTACTCTGCAAGAGGGTAAGGG + Intronic
1057003382 9:91533697-91533719 GCTGCTTAGTAGTAGGGGAATGG - Intergenic
1057198553 9:93128350-93128372 GCTGGTCTGTAGAATGGGAGAGG - Intronic
1057198798 9:93129659-93129681 GCTGGTCTGTAGAATGGGAGAGG - Intronic
1057817670 9:98307475-98307497 GCTGCCCTGCTGAAGCCGAAGGG - Intronic
1059149606 9:111937567-111937589 GCAGCTCTGGAGCAGGGGAAAGG + Intergenic
1059557884 9:115299742-115299764 GTGGCAGTGCAGAAGGGGAAAGG + Intronic
1060414369 9:123420264-123420286 GCCGCTCTGTAGACAGGGAAAGG + Intronic
1060600111 9:124871679-124871701 GCTGCTTCACTGAAGGGGAAAGG - Intronic
1060723667 9:125994145-125994167 GCTGCTCCCCAGCAAGGGAAGGG + Intergenic
1060791601 9:126489133-126489155 GCTGCCCTGGAGAACTGGAAGGG + Intronic
1060929396 9:127479447-127479469 GCTGCTCTGCTGAAGGAGCTGGG - Exonic
1061903179 9:133683419-133683441 TCTGGTTTGCAGAAGGGGAGGGG - Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062331947 9:136048775-136048797 CCAGCACTGCAGGAGGGGAAGGG + Intronic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203454295 Un_GL000219v1:150333-150355 GGTGCTGAGCAAAAGGGGAAAGG - Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1185784390 X:2877553-2877575 GCTGTTCTGCAGAAGGGATCAGG + Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186529945 X:10285302-10285324 GCTGCTCTGGAGCATGGGAGGGG + Intergenic
1186708714 X:12170431-12170453 GTTGCCCTGCAGATGAGGAATGG + Intronic
1187360021 X:18617283-18617305 GCTGCTCTGGAGAAGGTGCCAGG + Intronic
1188913346 X:35878726-35878748 GATCCTCTGGAGAAGGGGACAGG + Intergenic
1189098274 X:38162473-38162495 GCTGCTCTGAACAAAGGGACAGG + Intronic
1189284626 X:39842598-39842620 GCAGCTCTTCAGGAGGAGAAAGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190287705 X:48971802-48971824 GCAGCTCTGCAGAGGGGGCCAGG - Intergenic
1190333491 X:49249554-49249576 GCTGCTCTGCACGAGGTGAGGGG + Exonic
1190338933 X:49280981-49281003 GCTGCTCAGTAGGAAGGGAATGG + Intronic
1194189270 X:90815263-90815285 GCTGCTGAGCAAAGGGGGAACGG - Intergenic
1195280681 X:103330106-103330128 GCAGCGCTGCAGAAGTGGACCGG - Intergenic
1195382592 X:104284833-104284855 GCTGCTCTGCAAAGGGGAGATGG + Intergenic
1195889352 X:109675171-109675193 GCTGCTCTGCAGAAACAAAATGG + Intronic
1195922978 X:110001785-110001807 ACTGCTCTGGGGAGGGGGAAGGG + Intergenic
1197241136 X:124124440-124124462 GATGTTCTTCAGAAGGTGAATGG + Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1197905228 X:131417794-131417816 GCTGTTCAGAAGCAGGGGAAGGG - Intergenic
1198024000 X:132687242-132687264 GGAACTCAGCAGAAGGGGAAGGG + Intronic
1199601568 X:149544286-149544308 GCTGCAGTGCAGACTGGGAAAGG + Intronic
1199648809 X:149935198-149935220 GCTGCAGTGCAGACTGGGAAAGG - Intronic
1199756933 X:150873703-150873725 GCTGGTCTGCATAACAGGAAGGG + Intronic
1200412647 Y:2876875-2876897 GCTACTCAGCAGACTGGGAAAGG + Intronic
1200535847 Y:4397156-4397178 GCTGCTGAGCAAAGGGGGAACGG - Intergenic
1201423521 Y:13825079-13825101 GCTACTCAGCAGACTGGGAAAGG + Intergenic