ID: 999193080

View in Genome Browser
Species Human (GRCh38)
Location 5:149763148-149763170
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 2, 1: 0, 2: 5, 3: 91, 4: 688}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999193080_999193094 18 Left 999193080 5:149763148-149763170 CCCTCCCCACTCTGGCCCTGCAG 0: 2
1: 0
2: 5
3: 91
4: 688
Right 999193094 5:149763189-149763211 GCCTTTGGCCCTGGTCCTGCAGG 0: 1
1: 0
2: 2
3: 27
4: 263
999193080_999193089 3 Left 999193080 5:149763148-149763170 CCCTCCCCACTCTGGCCCTGCAG 0: 2
1: 0
2: 5
3: 91
4: 688
Right 999193089 5:149763174-149763196 CGCTTGCTCCCTCCGGCCTTTGG No data
999193080_999193087 -4 Left 999193080 5:149763148-149763170 CCCTCCCCACTCTGGCCCTGCAG 0: 2
1: 0
2: 5
3: 91
4: 688
Right 999193087 5:149763167-149763189 GCAGCCTCGCTTGCTCCCTCCGG 0: 1
1: 0
2: 1
3: 11
4: 174
999193080_999193090 9 Left 999193080 5:149763148-149763170 CCCTCCCCACTCTGGCCCTGCAG 0: 2
1: 0
2: 5
3: 91
4: 688
Right 999193090 5:149763180-149763202 CTCCCTCCGGCCTTTGGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 247
999193080_999193098 29 Left 999193080 5:149763148-149763170 CCCTCCCCACTCTGGCCCTGCAG 0: 2
1: 0
2: 5
3: 91
4: 688
Right 999193098 5:149763200-149763222 TGGTCCTGCAGGTCTCATTCTGG 0: 1
1: 0
2: 2
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999193080 Original CRISPR CTGCAGGGCCAGAGTGGGGA GGG (reversed) Intronic
900177924 1:1298919-1298941 CTGCAGGGCTGGGGTGGGGCCGG - Intronic
900326485 1:2110863-2110885 CTGTGGGGCCAGGGTGGGGCTGG + Intronic
900512390 1:3066832-3066854 CTGCAGGGTGAGGGTGGGGAAGG + Intergenic
900623819 1:3599152-3599174 CTGCGGGGCCAGCCTGGGGAGGG + Intronic
900640907 1:3687704-3687726 CTCTAGGGACAGAGAGGGGAGGG - Intronic
900651485 1:3732194-3732216 CTGCAGCCCCAGGCTGGGGATGG - Intronic
900743117 1:4342539-4342561 CTGCATGGTCCGAGAGGGGAGGG + Intergenic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900942126 1:5806307-5806329 CTGCAGGGCCTTAGTGTGGGAGG - Intergenic
900963255 1:5939458-5939480 CTGCAGGGCCTGGGTTGGGCAGG + Intronic
900986065 1:6073334-6073356 CTGCTGGGACAGAGCGGGGAGGG - Intronic
901056125 1:6449313-6449335 AGGCAGGCCCAGATTGGGGAAGG - Intronic
901194465 1:7432748-7432770 ATGCAGGGCCACAAGGGGGACGG - Intronic
901195753 1:7438990-7439012 CACCAGGGCCAGAGTGAGCAGGG + Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901287708 1:8094310-8094332 CTGCAGGGTCAGCGTGAGGCTGG + Intergenic
901455725 1:9361760-9361782 CTGGAGGGCAGGAGTGGAGATGG + Intronic
901476730 1:9495106-9495128 CCGGAGGGGCAGAGCGGGGAGGG + Intergenic
901629215 1:10640219-10640241 CTGCTGTGCCAGGGTAGGGAGGG - Intronic
901733049 1:11294461-11294483 CTGCAGGGCAAGAGAGATGAGGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902233482 1:15043085-15043107 CAGGAGGGCCAGCCTGGGGAGGG + Intronic
902478215 1:16699127-16699149 AGGCAGGCCCAGAGAGGGGAGGG + Intergenic
902478231 1:16699182-16699204 AGGCAGGCCCAGACTGGGGAAGG + Intergenic
902675632 1:18006675-18006697 CTGCAGAGCCCAACTGGGGAAGG - Intergenic
902714593 1:18263696-18263718 CTGCAGGGCCCCAGTGGGACTGG - Intronic
902717448 1:18282323-18282345 CACCTGGGCCAGAGTGGGGGTGG - Intronic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
903153578 1:21429676-21429698 CAGCAGGGACATAGTGGGGCTGG + Intergenic
903331107 1:22597653-22597675 CTGCAGGCCCCGAGAGGGGCAGG - Intronic
903478185 1:23634796-23634818 CTGGAGGGGCAGAGTGGGCGAGG + Intronic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
904182018 1:28672702-28672724 CACCCAGGCCAGAGTGGGGAGGG - Intronic
904266966 1:29323745-29323767 TGGCAGGCCGAGAGTGGGGATGG + Exonic
904321234 1:29698881-29698903 GAGCAGGGCCAGTGTGGGGGTGG - Intergenic
904331016 1:29757824-29757846 CTGCAGGGCCTCAGAGGGGATGG - Intergenic
904440498 1:30526550-30526572 CTGCAGGGCAGGGGTGGGGCAGG + Intergenic
904498396 1:30900607-30900629 ATGCAGGGCCTGAGTAGGCAAGG - Intronic
904603696 1:31687465-31687487 CTGCAGGGCTACAGTGGCCACGG + Intronic
904615676 1:31748287-31748309 GAGCTGGGCCAGAGAGGGGAAGG + Intronic
904617122 1:31755968-31755990 CAGCAGGGCCTGGGTGGGGCGGG - Intronic
904622010 1:31781424-31781446 CTGCACGTCCAGAGGAGGGAGGG + Intergenic
904629416 1:31829905-31829927 CTGCTGGGGAAGGGTGGGGAGGG + Intergenic
904647394 1:31978069-31978091 CTGCAGGGGCAGATGGGAGATGG + Intergenic
904896460 1:33821774-33821796 CTGTGGGACCACAGTGGGGAGGG + Intronic
904917178 1:33978521-33978543 CTGCAGGGTCAGGGTCAGGAAGG + Intronic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905266086 1:36755318-36755340 CTGGAGGGTCCAAGTGGGGATGG + Intergenic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906660480 1:47578219-47578241 CCGCAGGGCGAGGGTGGGGCAGG - Intergenic
907236555 1:53054543-53054565 GTGGGGGGCAAGAGTGGGGAGGG - Intergenic
907239175 1:53071157-53071179 CTGCAGGGCCAAGGAGGGGAAGG + Intronic
911288537 1:96027929-96027951 CTGCAGGAACAGTGTGGGGCAGG - Intergenic
912595947 1:110875754-110875776 CTGCTGGGGCAGAGGAGGGAAGG + Intronic
915612655 1:157006917-157006939 CTGCAGGGCCAGGCTGGCTAAGG + Intronic
916178429 1:162062645-162062667 GTTCAGAGCCAGAGTGGGGGTGG - Intergenic
916611571 1:166396866-166396888 AAGCAGGGCCAGAGAAGGGAGGG + Intergenic
916729714 1:167555062-167555084 TTGCAGGGGAGGAGTGGGGATGG - Intergenic
916836939 1:168555442-168555464 GTGCAGGGGCAGAGTGGAGGTGG - Intergenic
918070398 1:181129928-181129950 CCTCAGGGCCAGAGTGTAGAGGG - Intergenic
918127754 1:181599106-181599128 TCGGAGGGCAAGAGTGGGGAGGG - Intronic
918320793 1:183362422-183362444 CTGCAGGGCCAGGGGGCGGTGGG - Intronic
918689624 1:187465119-187465141 CTGCAGGGTCAGAATGGTGGAGG + Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
921043186 1:211453795-211453817 CTGCAAGGCCACAGTGAGGCTGG + Intergenic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
921472676 1:215567576-215567598 CTGCAGGGCCAGCGGGGCGGCGG - Exonic
922032194 1:221812338-221812360 AAGCGGGGCCAGAGTGGGCAGGG - Intergenic
922145819 1:222943123-222943145 CTGCAGGGCCAGCCTCGGGATGG - Exonic
922541095 1:226420530-226420552 CTGCTGGGCCAGTGTGAGGAAGG - Intergenic
922680447 1:227590872-227590894 CTGTATAGCAAGAGTGGGGAAGG - Intronic
922690413 1:227684740-227684762 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
922757151 1:228102834-228102856 CTGCCGGGGCAGGGTGGGGCCGG - Intronic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
923055435 1:230423299-230423321 CTGCATGGGTAGAGTGGGGTAGG - Intronic
923718608 1:236448252-236448274 CAGCACAGCCAGAGTGAGGAAGG + Intronic
924085330 1:240445479-240445501 ATGAAGGGGCACAGTGGGGAGGG + Intronic
1062925746 10:1314413-1314435 CTGCAGGGGCAGACCAGGGAGGG - Intronic
1064013298 10:11753681-11753703 CTGTAAGGCGAGACTGGGGATGG - Intronic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1064129389 10:12695470-12695492 CTACAGGGCCAGGGAGGAGAAGG - Intronic
1065609045 10:27452675-27452697 AGGCAGGGTGAGAGTGGGGATGG - Intergenic
1066628456 10:37434015-37434037 CTGGAGGAGCAGTGTGGGGAGGG + Intergenic
1067103319 10:43349065-43349087 GTGCAGGGCCGGGGCGGGGACGG - Intergenic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1067438776 10:46296665-46296687 CTGCAGCAACACAGTGGGGAGGG - Intronic
1067575533 10:47406249-47406271 CTGCAGCCCCACAGTGGGGAAGG - Intergenic
1068243710 10:54337643-54337665 CTAAAGGGCCAGTGTAGGGATGG - Intronic
1069458515 10:68572947-68572969 CTGCAGGGCCACTGTGGGTAGGG - Exonic
1069512392 10:69052206-69052228 CTGCTGGTCTGGAGTGGGGAAGG + Intergenic
1069744017 10:70703512-70703534 CTGCAGGCCTAAGGTGGGGAGGG + Intronic
1069947340 10:71997137-71997159 CTGCAGTGGAAGAGTGGGGAGGG - Intronic
1070141430 10:73741057-73741079 CTCCAGGGCCAGGGATGGGACGG - Intergenic
1070195305 10:74151247-74151269 CTGTAGAGCCAAAGTGGGGTGGG + Exonic
1070741251 10:78904567-78904589 GAGCAGGGTCAGAGTGGGGCTGG - Intergenic
1070752504 10:78972567-78972589 GAGCAGGGCCAGAGCTGGGAAGG + Intergenic
1070781420 10:79139600-79139622 CGGCAGGGACAGAGGTGGGAGGG + Intronic
1070823249 10:79375528-79375550 CTGCAGGAGCTGAGTGTGGAGGG + Intergenic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071564083 10:86662626-86662648 CACTAGGGCCAGAGCGGGGATGG + Intronic
1071610426 10:87026927-87026949 CTCCAGGGCCAGGGATGGGACGG + Intergenic
1072220251 10:93321012-93321034 TAGCAGGGGCAGAGTGGGAATGG + Intronic
1072251299 10:93584261-93584283 CTGCAGAGCCATTGAGGGGAGGG + Intronic
1073868311 10:107830669-107830691 CTGCAGGGGCACTGCGGGGATGG + Intergenic
1074146354 10:110720634-110720656 CTGCAGGGGCAGGGTGGGACAGG - Intronic
1074203282 10:111258602-111258624 CAGCGGGGCCAGACTGTGGAGGG - Intergenic
1074338161 10:112599223-112599245 CTGCAAGGCCAGAGTGAGGTAGG + Intronic
1074362232 10:112832836-112832858 CTGCAGGGCCAGGGCTGGGAGGG - Intergenic
1074778171 10:116781497-116781519 CTGAAGGGGAGGAGTGGGGAGGG + Intergenic
1075361647 10:121841765-121841787 CGGAAGGGCAAGAGTGGGTAAGG + Intronic
1075517521 10:123120448-123120470 CTGCAGGACATAAGTGGGGAAGG - Intergenic
1076256050 10:129025693-129025715 CTGGAGGGCCCTAGTGGGGGAGG - Intergenic
1076331131 10:129668332-129668354 ATGCTGGGCCAGAGTGGGCCAGG + Intronic
1076474560 10:130743186-130743208 CTGCAGTGCCTGATGGGGGAAGG - Intergenic
1076597924 10:131637411-131637433 CTCCAGGGCCAGCTTGGGAAAGG + Intergenic
1076704460 10:132293669-132293691 AGGCAGGGCCAGAGTGGGGGTGG + Intronic
1076815614 10:132913350-132913372 CTGCAGGGCAAGAAGTGGGAGGG + Intronic
1076887888 10:133270903-133270925 CTGCTGGGCCAGTGTGGGACAGG + Exonic
1076994340 11:290845-290867 CTGCAGGGCCTCAGTGAGGCAGG - Exonic
1077082388 11:729825-729847 CTGCGGGGCCTGACTGGGCACGG - Intergenic
1077392612 11:2307085-2307107 CTGCAAGGCCTGATGGGGGATGG - Intronic
1077409044 11:2395059-2395081 GTGCAGGGACAGGGTGGGGTGGG + Intronic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078164573 11:8871089-8871111 CTGCAGGGAGAGAGAGGGGAGGG + Intronic
1078460841 11:11514274-11514296 CTGCAGGGCCAGCCTGGGGCAGG - Intronic
1078605977 11:12775996-12776018 CGGCAGGGTCACAGTGGGCAGGG + Intronic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1080745315 11:35103516-35103538 CTGCAGGGCCACAGAGCAGATGG - Intergenic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1083090201 11:60191695-60191717 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1083155761 11:60821966-60821988 CTGCAGGGCCTGGGGGTGGAGGG - Intergenic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083626389 11:64074083-64074105 AGGCAAGGCCAGAATGGGGAGGG - Intronic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083683446 11:64361781-64361803 CTGCAGGGCCTGCCTGGGCAGGG + Intronic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083865074 11:65449239-65449261 CTGCAGGGCCAGAGAAAGGGGGG + Intergenic
1084082554 11:66838158-66838180 GTGAATGGCCAGAGTGGAGAAGG + Intronic
1084582413 11:70032276-70032298 CTGCAGGCCCAGGGCTGGGAAGG + Intergenic
1084610987 11:70203012-70203034 GTGCAGGGCCGGGGCGGGGAGGG - Intergenic
1085150706 11:74250973-74250995 CTGCATGGCCACACTGGGGTAGG - Exonic
1085203719 11:74717754-74717776 GTGCAGGGAAAGAGTGGGGCTGG + Intronic
1085386575 11:76161352-76161374 AAGCAGGGACAGCGTGGGGAGGG + Intergenic
1085460013 11:76687920-76687942 CTGAAGGGACAGACTGGGGCAGG + Intergenic
1085782224 11:79419822-79419844 CTGAAGGCCCAGAGAAGGGAAGG - Intronic
1086897303 11:92328165-92328187 CAGGAGGGCAAGAGTGGGTAAGG - Intergenic
1087542691 11:99541482-99541504 CTGGAGGGCCAAAGAGGAGATGG + Intronic
1087572093 11:99941791-99941813 CAGCAGGGCCAGTGTGGCTAGGG + Intronic
1087684836 11:101250807-101250829 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1088394455 11:109351077-109351099 ATGCAGGGCTAGGGTGAGGATGG - Intergenic
1088625491 11:111727466-111727488 CTCCAGCACCAGAGTTGGGAAGG - Exonic
1088822756 11:113470537-113470559 CTGAAGGGACAGGGAGGGGAAGG - Intronic
1088900860 11:114115957-114115979 CTTCATGGACAGGGTGGGGAGGG - Intronic
1089014995 11:115158266-115158288 AAGCAGTGCAAGAGTGGGGATGG + Intergenic
1089163032 11:116454178-116454200 CTGCACGGCCACAGTGCGAATGG - Intergenic
1089330920 11:117688405-117688427 CAGCAGGACAAGAGTTGGGAAGG + Intronic
1089494941 11:118903135-118903157 GTGCAGGGGCAGGGTGGGGTGGG - Intronic
1089556586 11:119318652-119318674 CTGCTGGGCTGGAGTGGGAATGG + Intronic
1089774060 11:120823888-120823910 CTCCAGGGCCAGAGCAGGGAAGG + Intronic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090227342 11:125079661-125079683 CTGCAGGGAGAGAGAAGGGAGGG - Intronic
1090599776 11:128358202-128358224 CTGAAGGGCCGGAAAGGGGAGGG + Intergenic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091404264 12:199134-199156 CAGCAGGGGGAGGGTGGGGAGGG + Intronic
1091701697 12:2667632-2667654 ATGCAAGGCAAGGGTGGGGAGGG + Intronic
1093059666 12:14589426-14589448 CTGCAGAGACAGGGTGGGGGGGG + Intergenic
1093383585 12:18523694-18523716 CTTCATGGCCAGAGTTGGGCAGG + Intronic
1094032745 12:26031719-26031741 CTGCGGGATCAGAGTGGGAATGG + Intronic
1094236559 12:28174106-28174128 CTGGAGGGCCAAAGTGAGGGTGG + Intronic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095428568 12:42107348-42107370 CTGCAGGGCCTGAGTAGGGAAGG + Intronic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1095956893 12:47812110-47812132 CTGCTGTGCCAGCTTGGGGAGGG - Intronic
1096522797 12:52193569-52193591 ATGCCAGGCCAGAGTGAGGACGG - Intergenic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1096673623 12:53214785-53214807 CTGCAGGCCCTGGGTGGGGCTGG - Intronic
1096715205 12:53487036-53487058 CTGCAGTGCCAGAGTGGCAGTGG - Exonic
1096770646 12:53934008-53934030 CTGCAGAGCCAGAGAGGAAAAGG + Intergenic
1096777093 12:53970881-53970903 CTGGAGGGCCAGGAGGGGGAAGG + Intergenic
1097017521 12:55997879-55997901 CAGCAGGGCCAAAGTGAGGAGGG - Intronic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1098245826 12:68516827-68516849 CTGCAGAGGTAGAGTGGGGTCGG - Intergenic
1098248711 12:68546469-68546491 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1101150321 12:101877572-101877594 CTGCCGGGCCAGAGTGGGTGGGG - Exonic
1101865398 12:108516249-108516271 ATGGAAGGCCAGAGAGGGGAAGG + Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102440822 12:112962943-112962965 CTCCAGGGTGACAGTGGGGAGGG - Intronic
1102459966 12:113094015-113094037 CTGCAGGGACACAGCGGGGTGGG - Intronic
1102650871 12:114441519-114441541 CTCCAGGCCCAGAGAGGGGAAGG + Intergenic
1102875262 12:116444093-116444115 CTGGCGGGGCAGAGTGGGTATGG + Intergenic
1102950642 12:117028510-117028532 CTGCAGGGCTGGAGCTGGGAGGG - Exonic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1103459188 12:121090145-121090167 CTGCAGGCCCAGCCTGGGGCCGG + Intergenic
1103684797 12:122723474-122723496 CACCAGGGACACAGTGGGGAAGG - Intergenic
1103781576 12:123402302-123402324 CTGCAGGGCCGCAGTGGGAATGG + Intronic
1103995743 12:124828913-124828935 CTGCTGGTCCAGAGTGGGCAGGG - Intronic
1104671986 12:130686783-130686805 CTGCAGGGCCGGAGGAGGAAGGG + Intronic
1104672261 12:130688891-130688913 CTGCTGGGCAAGAGTGGGGTGGG - Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104874810 12:132026475-132026497 CTGCAAGGCTGGAGTGGGGAGGG + Intronic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1105752290 13:23432497-23432519 CTTCAGGGCAAGATTAGGGAAGG + Intronic
1107087174 13:36437778-36437800 CTGCTCGGTCAGAGAGGGGATGG + Exonic
1108226026 13:48290202-48290224 GTGCAGGGCCAGAGGTGGGAAGG - Intergenic
1108636605 13:52341441-52341463 CTGCAGGGCAAGAGCTGGGGAGG + Intergenic
1111412532 13:87895290-87895312 CTGCAGGGCCACTGAGGGTAGGG + Intergenic
1112330596 13:98474505-98474527 CTGAAGGGCCATGGTGGTGAGGG - Intronic
1112718814 13:102218348-102218370 CTGCAGGTCCAGCGTGGGCCTGG - Intronic
1113821212 13:113214800-113214822 CTGCAGGCCCAGCGTAGGAATGG + Intronic
1113929043 13:113956840-113956862 CTGCAGGGCGAGAGGAGGGCAGG + Intergenic
1114263239 14:21054552-21054574 TTGAAGTGACAGAGTGGGGATGG - Intronic
1114543609 14:23482505-23482527 CTGAAAGGACAGAGTGGGGTTGG + Intronic
1114614096 14:24059256-24059278 CTGCAGGGACTGTGTGGGCAAGG - Exonic
1114665039 14:24372694-24372716 CTGCAGGGTCAGAGCTGAGAGGG - Intronic
1115354817 14:32436101-32436123 GGGCAGGCCCAGACTGGGGATGG + Intronic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1116550794 14:46235111-46235133 TTACAGGGCCAGAGTGCCGAGGG - Intergenic
1117336903 14:54763703-54763725 GTACAGGGCCACAGTGGAGATGG - Intronic
1118846491 14:69551280-69551302 ATGCTGGGCCAAAGTGGGGGTGG + Intergenic
1119195789 14:72715837-72715859 CTGCAGGGGTGGGGTGGGGAGGG - Intronic
1119728473 14:76936519-76936541 TTGAAGGGCCAGCCTGGGGATGG - Intergenic
1119757726 14:77130662-77130684 TTGCAGGGCCTGAGAGGGCAGGG + Intronic
1120914843 14:89701796-89701818 CTGCGGGGCCGGAGTGGGGGAGG + Intergenic
1120997153 14:90425645-90425667 CTGCAGGGCCTGAGAGGTGAGGG + Intergenic
1121202304 14:92128523-92128545 ATGCAGGGCCGGCGGGGGGATGG - Intronic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121596486 14:95167372-95167394 CTGCAGGGCCAGAGTCCTCATGG + Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121798757 14:96756136-96756158 TGGCAGGGCCAGGGAGGGGATGG - Intergenic
1121837477 14:97105157-97105179 CATCAAGGCCAGAGAGGGGATGG - Intergenic
1121853656 14:97246655-97246677 CTGGAGAGCCAGGGTGGGCATGG + Intergenic
1122129276 14:99595765-99595787 CAGCAGGGGCAGGGTGGGGCTGG - Intronic
1122362200 14:101174185-101174207 ATGGAGGCCCAGGGTGGGGATGG - Intergenic
1122740374 14:103868533-103868555 CTGGGGGCCCAGAGTGGGCAGGG - Intergenic
1122838546 14:104443289-104443311 CTCAGGGTCCAGAGTGGGGAGGG - Intergenic
1122960455 14:105091696-105091718 CTGCAAGGCAAGGGTGGGGCAGG - Intergenic
1123139676 14:106062682-106062704 CTGCAGGGTCAGGGTTGGGTTGG + Intergenic
1123187990 14:106538343-106538365 CTGCAGGGTCAGGGTTGGGTTGG + Intergenic
1124237910 15:28005409-28005431 CTGCAGGACCAGAGGAGGGTGGG - Intronic
1124243439 15:28050906-28050928 CTGCAGGGCAAGGATGGGGCGGG - Intronic
1124456362 15:29846329-29846351 GTGCAGGGCCTGAGCTGGGAAGG - Intronic
1124878502 15:33619695-33619717 CTGCAGGCCCAAGCTGGGGAAGG - Intronic
1125084454 15:35714083-35714105 CTGCTGAGCCACAGTGGGGAAGG - Intergenic
1125514419 15:40309678-40309700 CTCCAGGCCCAAAGTGGAGAGGG - Intergenic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1125859729 15:42987187-42987209 CGGCAGGGGCAGAGCCGGGATGG + Intronic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1127267111 15:57371336-57371358 CAGCAGGCCCAGAGTGTGGATGG + Intergenic
1127391143 15:58506059-58506081 CCACAGAGACAGAGTGGGGAGGG - Intronic
1127875630 15:63109048-63109070 CAGCAAGGAGAGAGTGGGGATGG - Intergenic
1128221276 15:65970374-65970396 CTGCAGGCCGAGGGTGAGGAGGG + Intronic
1128229362 15:66024062-66024084 CTGCAGGCTCAGGGTGGGGCTGG + Intronic
1128241072 15:66101330-66101352 TTGAAGGCCCAGTGTGGGGAGGG - Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1128648697 15:69395239-69395261 CTCCAGGGGCAGAGCGGGCAGGG + Intronic
1128716765 15:69914292-69914314 CTGCAGGGCAGGAGCAGGGACGG - Intergenic
1128717327 15:69918193-69918215 CTGGAGGGCCGGAGCTGGGAAGG + Intergenic
1129152768 15:73699496-73699518 CTCCTGGACCAGAGTGGGGAAGG - Intronic
1129190610 15:73935484-73935506 GTGCAGGGCCTGAGAGGGCAAGG + Intronic
1129361915 15:75029623-75029645 CAGCCAGGCCAGAGTGGGGGAGG + Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1129692564 15:77722036-77722058 CTGCAGGTGCAGAGAGGGGTGGG - Intronic
1129709602 15:77813884-77813906 CTTCTGGGGCAGGGTGGGGAGGG - Intronic
1129727648 15:77909680-77909702 TGGGAGGGCCAGGGTGGGGAGGG - Intergenic
1129883914 15:79025632-79025654 CTGCAGGGCCAGATGGCTGAGGG + Intronic
1130555849 15:84922143-84922165 CTGCAGGGAGGGAGTGTGGATGG - Intronic
1130652894 15:85772383-85772405 TGGCAGGGCCAGGGTGGGGCAGG - Intronic
1131514903 15:93070956-93070978 CTGCATGGCCTGAGTGGTGGTGG - Intronic
1131525423 15:93148632-93148654 CTGGAGGGGCAGGGTGGGAACGG - Intergenic
1132075500 15:98816593-98816615 CTGCAGCTACAGAGTGGGTAAGG - Intronic
1132146966 15:99434924-99434946 CTGCAGGTCCGGGGTGGGGCTGG - Intergenic
1132242165 15:100266337-100266359 CTGCAGGGCCAGAGTGCTGCTGG + Intronic
1132466091 16:78036-78058 CTGCGAGGCGAGAGCGGGGAAGG - Intronic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132599065 16:765867-765889 CTGCAGAGCCAGGGAGGGGCAGG - Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132805364 16:1772765-1772787 CTGCAGGGGCGGGGTGCGGACGG + Intronic
1132856776 16:2048515-2048537 CTGGAGGTCCGCAGTGGGGAAGG + Intronic
1133005959 16:2882227-2882249 CTGCAGAGCCAGGGCCGGGAGGG + Intergenic
1133222456 16:4324558-4324580 CTGCAGTGGCATAGAGGGGATGG + Intronic
1133281259 16:4666709-4666731 CTGCAGGGTCAGAGTGCCGCAGG - Intronic
1133322908 16:4925235-4925257 CTGGAGGGCCAGCTTGGGGGAGG + Intronic
1133328721 16:4958196-4958218 GGGCGGGGCCAGAGTGGGGCGGG + Intronic
1133331366 16:4976686-4976708 CTGCAGGGCCACAGTGGGGCAGG - Intronic
1133467405 16:6041110-6041132 CTGCAGGGGGAGAGCAGGGAGGG - Intronic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134809629 16:17156494-17156516 CTGCAGGAGCAAAGTGGGGCTGG - Intronic
1136038934 16:27562660-27562682 TTGGAGTGCCAGAGTGGGAATGG + Intronic
1136120603 16:28130899-28130921 CTGAAGGGTCAGTGTGGGGGAGG + Intronic
1136580927 16:31150252-31150274 CTGGAGGCCCAGGGTGGGGGTGG + Intergenic
1136634435 16:31510647-31510669 CAGCATGTCCTGAGTGGGGAGGG + Intergenic
1137579243 16:49623231-49623253 CTGCAGGGCAGGAATGGGCAAGG + Intronic
1137722407 16:50635160-50635182 CCCCTGGGCCTGAGTGGGGAAGG + Exonic
1138122693 16:54413215-54413237 CTGCTGGGCCAGTCTGGGGCAGG + Intergenic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1138590993 16:57999935-57999957 CAGGAGGGCCAGGGTGGGCAGGG - Intronic
1138657415 16:58499366-58499388 CAGCAGGGTGAGGGTGGGGAGGG + Intronic
1139480816 16:67229719-67229741 CTGCAGGGACAGAGCAGGGTTGG + Intronic
1139515549 16:67450452-67450474 CTGCTGGGGCAGAGCGGAGAAGG + Intronic
1139523524 16:67499159-67499181 GAGCAGGGCCAGGTTGGGGAGGG - Intergenic
1139692265 16:68648772-68648794 AAGCAGGGCCTGAGTGGAGAGGG + Intronic
1141170244 16:81686399-81686421 CTGCAGTGCTTGAGTGCGGAAGG - Intronic
1141526395 16:84614564-84614586 CCTGAGTGCCAGAGTGGGGAGGG + Intronic
1141673883 16:85507386-85507408 CTCCTGGGCCGGGGTGGGGAGGG + Intergenic
1142143828 16:88484415-88484437 CTGATGGGGCAGAGTGGGGGTGG - Intronic
1142153807 16:88524203-88524225 CAGGAAGGCCAGGGTGGGGAGGG + Intronic
1142239201 16:88937488-88937510 CGGGAGGGCCAGCGTGGGGACGG - Intronic
1143017303 17:3897835-3897857 CTGCAGGCCCAGGGTGGAGCTGG + Exonic
1143376442 17:6470320-6470342 GGGCAGGGCCACGGTGGGGAAGG + Exonic
1143550978 17:7630324-7630346 CTACAGGGCCAGAGGAGAGAAGG - Intronic
1143571310 17:7760377-7760399 CAGGGGGGCCAGACTGGGGAAGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144202744 17:12956023-12956045 CTGCAGGGCCTGAGCAGGGTGGG + Intronic
1144304701 17:13957732-13957754 CAACAGGCCCAGAGAGGGGATGG - Intergenic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1145205585 17:20983459-20983481 GGGCAGGGCCAGAGTAGGGGAGG + Intergenic
1145218543 17:21070093-21070115 CTGCAGGGCTGGGGTGGGAAAGG + Intergenic
1145240615 17:21239180-21239202 GTGCCGGGCCAGTGTGGAGAAGG - Exonic
1145785531 17:27591445-27591467 ATGCAGGGGCAGAGTGGGCTGGG - Intronic
1145866701 17:28246516-28246538 CTACTGGGCCAGAGATGGGAGGG - Intergenic
1145889035 17:28402124-28402146 CTCCAGGGTGAGAGGGGGGAAGG + Exonic
1146357013 17:32142762-32142784 CTGCAGGGGCAGGGAGGGCAGGG - Intronic
1146671288 17:34739839-34739861 GAGCAGGGCAAGATTGGGGAAGG - Intergenic
1146764477 17:35506865-35506887 CTGTATAGCAAGAGTGGGGAAGG + Intronic
1146842239 17:36164101-36164123 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1146854550 17:36252060-36252082 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1146866070 17:36336316-36336338 CTGCAGGGCTTGAGAGGGAACGG + Intronic
1146870450 17:36375952-36375974 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1146877807 17:36427033-36427055 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1147068940 17:37936928-37936950 CTGCAGGGCTTGAGAGGGAACGG + Intergenic
1147073333 17:37976576-37976598 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1147080464 17:38016465-38016487 CTGCAGGGCTTGAGAGGGAACGG + Intronic
1147084854 17:38056114-38056136 CTGCAGGGCTTGAGAGGGAACGG - Intronic
1147096411 17:38140425-38140447 CTGCAGGGCTTGAGAGGGAACGG + Intergenic
1147100802 17:38180080-38180102 CTGCAGGGCTTGAGAGGGAACGG - Intergenic
1147606267 17:41775510-41775532 CTCCAGGTCCAGGGTGGAGAGGG - Intronic
1147606628 17:41777350-41777372 AGCCAGGGACAGAGTGGGGAAGG - Intronic
1147966901 17:44198951-44198973 CTGCCGGCCTAGAGTGGGGTGGG + Intronic
1148147356 17:45374129-45374151 CTGCAGGGAAAGAGAGGAGAGGG - Intergenic
1149356030 17:55840167-55840189 CTGCTGGGACAGGGTGGGGGTGG + Intronic
1149698123 17:58633078-58633100 CTGTAAGGCCAGAGTGTGGCTGG - Intronic
1149845389 17:60006544-60006566 CTGCAGGGCTTGAGCGGGGAAGG - Intergenic
1150069465 17:62139154-62139176 CTCCCGGGCCAGGGTGGTGAAGG + Intergenic
1150083737 17:62263127-62263149 CTGCAGGGCTTGAGCGGGGAAGG - Intergenic
1150125188 17:62630571-62630593 CTGGGAGGCCAGAATGGGGATGG + Intronic
1150280986 17:63929530-63929552 CTGCTGGGCCAGGCTGGGGAGGG + Intronic
1150444333 17:65216963-65216985 CTTGAGGGCCAGAGAGTGGATGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1151448318 17:74181609-74181631 CTACAGGCCCAGGGTGGGGAGGG - Intergenic
1151679919 17:75617749-75617771 CTGCAGAGCCAGAGTGATGGGGG - Intergenic
1151884960 17:76918118-76918140 CTGCAGACCCAAAGTGGGGCTGG - Intronic
1151888410 17:76937819-76937841 TTTCAGGGCCAGAGAGGGGCGGG + Intronic
1152233314 17:79125659-79125681 CTGGAGGGCCTGAGAGGAGAGGG - Intronic
1152243119 17:79170413-79170435 CTCCAGGGCCAGGGGAGGGAAGG + Intronic
1152380926 17:79941924-79941946 CTGGGGGGCCATGGTGGGGATGG + Intronic
1152629563 17:81404443-81404465 GGCCTGGGCCAGAGTGGGGAGGG + Intronic
1152861541 17:82699060-82699082 CTGCACGCCCCGAGTCGGGAGGG + Intergenic
1153317613 18:3740480-3740502 CTCCAAGGGCAGAGTAGGGAGGG - Intronic
1153342995 18:3994335-3994357 CTTCAGGCCTAGAGTGGCGAGGG + Intronic
1153959762 18:10130818-10130840 CTGCAGGCCTAGAGTAGGAAGGG - Intergenic
1155933967 18:31735681-31735703 ATGCTGGGGCAGAGTGGGGCTGG + Intergenic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1157298511 18:46462718-46462740 CTGCAGGGTCAGAGTGGAAAGGG + Exonic
1157332264 18:46712542-46712564 CTGCAGGCACAGAGGAGGGAGGG - Intronic
1157473820 18:48008887-48008909 CTGGAGGTCGAGAGTGGGGGAGG - Intergenic
1159101367 18:63962695-63962717 CTGCAGGGCCACAGTTGAAAAGG + Intronic
1159837188 18:73352611-73352633 CTGCTGGGCCAGAATGGGGGAGG + Intergenic
1160006917 18:75074850-75074872 CTCCAGGCCAAGAGTGAGGATGG + Intergenic
1160204724 18:76822960-76822982 CGGCAGGGCCAGCGGGGGCAGGG - Intronic
1160239781 18:77114869-77114891 CTGCAGGGAGGAAGTGGGGAAGG + Intronic
1160340614 18:78085779-78085801 CTGCTGTGCCAGGCTGGGGAAGG - Intergenic
1160406755 18:78651693-78651715 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160406770 18:78651748-78651770 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160727223 19:622699-622721 CTCCCGGGCCAGGGTGGTGAAGG + Exonic
1160934286 19:1585789-1585811 CAGCAGGGCCAGACTGGGAAGGG + Intronic
1160953339 19:1678021-1678043 GGGCAGGGCCAGAGCAGGGATGG + Intergenic
1161217372 19:3101145-3101167 CTGCAGGGACGGAGTGGGGTGGG + Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161391268 19:4022036-4022058 CTGCAGGTCCAGATTGGGCATGG - Intronic
1161520770 19:4722614-4722636 CTGCAGCTCCTGAGTGGGGGAGG - Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG + Intergenic
1162084459 19:8240225-8240247 CAGCAGGGCCAGAATGTAGAGGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162527045 19:11212152-11212174 CTGCAGGGACAGGGGCGGGAGGG + Intronic
1162798980 19:13100863-13100885 GTGCAGGGCCAAAGTGGGCGGGG + Exonic
1163053224 19:14700613-14700635 ATTCAGGGCCAAAGGGGGGATGG - Intronic
1163492977 19:17627799-17627821 CTGCAGGGACACAGTGGTGGGGG + Intronic
1163526557 19:17824908-17824930 CCCCAGGGCCAGAGTGGGGCTGG + Exonic
1163747183 19:19055483-19055505 CTGCAGGGCCAGGGCAGGGCTGG + Intronic
1163756651 19:19110546-19110568 CTGCAGGGCGAGGGGCGGGAGGG - Intronic
1164398202 19:27884558-27884580 CTGAAAGGGCAGACTGGGGAAGG + Intergenic
1164676457 19:30104774-30104796 CTGCATGGACACAGAGGGGATGG - Intergenic
1164722734 19:30444269-30444291 CTGCAGGGCCAGGGTGCAGGCGG - Exonic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1164839954 19:31385697-31385719 TTTGAGGGCCAGAGAGGGGAAGG + Intergenic
1165124741 19:33585971-33585993 CTGCCTGGCGAGAGTGGGCAGGG - Intergenic
1165166886 19:33863275-33863297 CTGCAGGGGGAGGGTGGAGAGGG + Intergenic
1165462931 19:35954671-35954693 TGGCAGGGCCAGTGCGGGGAGGG - Intergenic
1165797329 19:38526664-38526686 CTGGGGGGTCAGAGTGGGGCAGG - Intronic
1167455309 19:49594634-49594656 CTGCAGGGCCAGGGTGGGACTGG + Intronic
1167492544 19:49800947-49800969 CTGGAGCGCCTGAGTGGGGTGGG - Exonic
1167502438 19:49855608-49855630 GTGCAGGGACTGAGTGGGGCAGG + Intronic
1167512229 19:49901484-49901506 GTCCAGGCCCAGATTGGGGAAGG + Intronic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
1168208246 19:54868772-54868794 CTACAGGGACAGTGTGGGGGAGG + Intergenic
1168277433 19:55285372-55285394 CTCCAGGGCCAGGGAGGGGATGG + Intronic
1168350164 19:55671012-55671034 CTGCAGGGCCAGATCGGGCGTGG + Intronic
1168432058 19:56289095-56289117 CTGCAAGGGGAGAGTGGGAAAGG + Intronic
1168591955 19:57643751-57643773 CTTGAGGGCCAGAGAGGGGAGGG - Intergenic
1202712236 1_KI270714v1_random:24955-24977 AGGCAGGCCCAGAGAGGGGAGGG + Intergenic
1202712252 1_KI270714v1_random:25010-25032 AGGCAGGCCCAGATTGGGGAAGG + Intergenic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
926052032 2:9751489-9751511 CTCCAGGGACAGAGTGTGGACGG - Intergenic
926200475 2:10792789-10792811 TTGTAGGTCCAGAGTGGGGATGG - Intronic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926619805 2:15037255-15037277 ATGCAAGGCCAAAGTGGGGCAGG + Intergenic
927432311 2:23037111-23037133 ATTCAGGGCCAGAGTGGGTAGGG - Intergenic
927865155 2:26583395-26583417 GTGCTGGGACAGAGTGGGGAGGG + Intronic
927926695 2:27018651-27018673 CCGAAGGGGCAGAGTGGGTAGGG - Intronic
928006911 2:27570733-27570755 CTCCAGGGCCAGAGGGGGAAGGG + Intergenic
928324298 2:30307525-30307547 CTGACAGGCCAGAGTAGGGAAGG - Intronic
929454519 2:42056376-42056398 ATCCATGGCTAGAGTGGGGAGGG - Intronic
929471306 2:42196760-42196782 CTGCATGGGCAGAGGGGGAAGGG - Intronic
929554436 2:42916566-42916588 CTGGAGGGGCTGAGTAGGGAGGG + Intergenic
929811340 2:45191431-45191453 TTGCCCGGCCAGAGTGGGCAGGG + Intergenic
930722788 2:54653958-54653980 CTTCAAGGCCAGAGTGGGGGTGG + Intronic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932362285 2:71118824-71118846 TTGCAGTGTCAGAGTGAGGAGGG - Intronic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932493193 2:72134200-72134222 CTGCAGAGCCCAGGTGGGGATGG + Intronic
934035927 2:88088437-88088459 CTGTCAGGCCAGAGTTGGGAGGG + Intronic
934521530 2:95023075-95023097 TTGCAGAGCCAGCCTGGGGAAGG - Intergenic
935319356 2:101870804-101870826 CTGCAGTGCCACAGTGGGAGCGG + Intronic
935359770 2:102237443-102237465 CTGCAGTGCTGGAGTGGGCAGGG - Intronic
935721169 2:105980578-105980600 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
935729724 2:106055426-106055448 GAGCAGTGCCACAGTGGGGATGG + Intergenic
936370874 2:111901192-111901214 CTGAAGGGCCAGGGAGAGGATGG + Intronic
937297473 2:120818222-120818244 CTGCAGGGCAGGGGTGTGGAGGG + Intronic
937518929 2:122687129-122687151 TGCCAGGGTCAGAGTGGGGAGGG + Intergenic
937667030 2:124499437-124499459 CTGCAGGGCAAAAGTGGGGATGG + Intronic
937906987 2:127057247-127057269 ATGCAGGGCCACAGAGGGGAAGG - Intronic
938548884 2:132361300-132361322 CTGCAGGATCTGGGTGGGGAAGG + Intergenic
940243525 2:151589304-151589326 CCGCAGGGCCAGACTAAGGAAGG + Intronic
940244481 2:151599857-151599879 CCGCAGGGCCAGACTAAGGAAGG + Intronic
941883218 2:170502542-170502564 CTGAAGAGCCAGAGAGGGGACGG - Intronic
942068455 2:172293948-172293970 CTCTTGGGCCAGAGTTGGGAAGG + Intergenic
942277597 2:174334505-174334527 CAGCAGGGCCCAAGTGGAGACGG - Intergenic
942461653 2:176172367-176172389 CGGCAGGGCAAGAGCGGGGAAGG - Exonic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
945146052 2:206739306-206739328 CTTCAGGGGCTGAGTTGGGAGGG + Intronic
945348841 2:208752209-208752231 CTGCAAGGCCACAGTGAGGCTGG - Intronic
945754450 2:213829484-213829506 TTGCTTGGCCATAGTGGGGAAGG - Intronic
946279959 2:218659561-218659583 CTTCAGGGCTGGAGTGGGGGTGG - Intronic
946302556 2:218832693-218832715 CTCCAGGGCCAGGGCTGGGATGG - Intergenic
946308710 2:218871241-218871263 CAACAGGGTCAGTGTGGGGAGGG + Exonic
946555270 2:220849377-220849399 CTACAGGGCTAGAGGGTGGAGGG + Intergenic
946678373 2:222186897-222186919 CTGCATGGCCAGAGAAGAGATGG - Intergenic
947267686 2:228301159-228301181 CTGAAAGGGCAGACTGGGGAGGG - Intergenic
947496746 2:230643264-230643286 CTGCAGGACTAGAGTGGGCAGGG - Intergenic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947979587 2:234397731-234397753 ATGCAGGGTCAGAGAGGGAATGG + Intergenic
948076477 2:235168709-235168731 CAGCAGGGCCAGATGGGGAAGGG + Intergenic
948220779 2:236268011-236268033 CAGCTGACCCAGAGTGGGGAGGG - Intergenic
948485297 2:238276970-238276992 CTGAAAGGCCAGAGTGAGGCTGG + Intronic
948690304 2:239697934-239697956 CTGCAGGGCTAACGTGGGGGAGG + Intergenic
948845855 2:240682541-240682563 CTGCAGGGACACGGTGGGGTTGG + Exonic
948848004 2:240692189-240692211 CTGCAGGGACACAGTGGGGTTGG - Exonic
948869745 2:240792004-240792026 TGGCAGGGCCAGGGTGGGGTGGG - Intronic
948915668 2:241034088-241034110 CTGCAGGGGCAGGGCGGGGCAGG - Intronic
1169147010 20:3259339-3259361 GTGAAGGCCCAGGGTGGGGAAGG + Intronic
1169876015 20:10297726-10297748 CTGCAGGGCAAGAGGAGTGAGGG - Intronic
1170791342 20:19511960-19511982 CTCCAGGGTCAGGGTGGGCAAGG - Intronic
1170962445 20:21037392-21037414 CTGCAGGGCCAGGAGGGGCAGGG + Intergenic
1171296490 20:24021640-24021662 GTGCAGGGCCAGTGTTGGGCAGG + Intergenic
1171340690 20:24425245-24425267 CTGCAGGAACACAGTGGAGATGG + Intergenic
1171464792 20:25319882-25319904 CTGCAGCTCCAGATAGGGGACGG + Intronic
1171877708 20:30593827-30593849 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1173595616 20:44257123-44257145 CGCCAGGGTCAGAGCGGGGAAGG - Intronic
1173686085 20:44924330-44924352 CTGCTGGGCGAGAGGGTGGAGGG - Intronic
1173869348 20:46331803-46331825 CCGCAGGGGCAGAGGAGGGAGGG + Intergenic
1174080812 20:47969558-47969580 GGGCAGGGCCAAAGTGGGGCAGG + Intergenic
1174171477 20:48620480-48620502 CTGGAGGGCTGGAGTGGGGCAGG - Intergenic
1174182367 20:48682894-48682916 TTACAGGGCCAGAGGGGGGCAGG + Intronic
1174387995 20:50198230-50198252 ATGCAGGGCTGGAGTGGGGGAGG + Intergenic
1174470973 20:50760614-50760636 CCAAAGGGCCAGAGTGGGGCAGG + Intergenic
1174875285 20:54220992-54221014 CTGCAGGGCCTGGGAGGGGTGGG + Intronic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175863301 20:62161559-62161581 CTGCAGGGCCAGATTGGCAACGG + Exonic
1176046722 20:63096775-63096797 CTGAGTGGCCACAGTGGGGATGG + Intergenic
1176098935 20:63356275-63356297 GGGCAGGGCCAGGGTGGGGCAGG + Intronic
1176162148 20:63653418-63653440 CTGCAGTGCCGGGGAGGGGAGGG + Exonic
1176169252 20:63689619-63689641 ATGAAGGGCCAGGGTGGGGCTGG + Exonic
1176376165 21:6087789-6087811 CCTCAGGGCCACATTGGGGAGGG - Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1176988195 21:15462323-15462345 CAGTAGGTCCTGAGTGGGGAGGG - Intergenic
1177197601 21:17919284-17919306 CTGCAGGGGCAGAGTGCTCATGG - Intronic
1177821361 21:26034241-26034263 TTGCAGGGAGAGAGAGGGGAAGG - Intronic
1178884728 21:36476214-36476236 GTGCAGGGCCACAGGAGGGAAGG - Intronic
1178908281 21:36653960-36653982 CAGCAGGCCCAGGCTGGGGAGGG - Intergenic
1179570071 21:42273452-42273474 CGGCAGGGGCGGAGTGGGGCGGG - Intronic
1179747310 21:43450455-43450477 CCTCAGGGCCACATTGGGGAGGG + Intergenic
1179948869 21:44698472-44698494 CTGCTGGGCTGGGGTGGGGACGG - Intronic
1179970853 21:44836163-44836185 CTGCAGGGGTAGGGTGGGGATGG - Intergenic
1179988150 21:44932462-44932484 CTGCGGGGCCAGAGTGGGCTGGG + Intergenic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1180744810 22:18080097-18080119 CTGGAGGGCAATAGTAGGGAAGG - Intronic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1180948410 22:19709328-19709350 CTGCCGGGACAGCCTGGGGATGG + Intergenic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182067327 22:27439828-27439850 CTGCAGCCCCAGAGAGTGGATGG + Intergenic
1182252104 22:29009075-29009097 CTGCAGGGCCACTGTGAAGAGGG + Intronic
1182685460 22:32119654-32119676 CTGCAGGGCCAGCCTGGGCTGGG - Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183346946 22:37313222-37313244 GGGCAGGGCCAGAGTGGGTGAGG - Intronic
1183458643 22:37936381-37936403 CAGGAGGGACAGAGTGGGGCAGG - Intronic
1183479430 22:38055276-38055298 AAGAAGGGCCAGAGTGGGTAGGG + Intergenic
1183678130 22:39311114-39311136 CTGCAGAGCCAAAGATGGGAGGG + Intergenic
1184309018 22:43629111-43629133 CTGCAGGGACAGAGGTGTGAGGG + Intronic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
1184650017 22:45915383-45915405 CTGCAGGGCCACAGGTGGGTGGG + Intergenic
1184650054 22:45915506-45915528 CTGCAGGGCCACAGGTGGGTGGG + Intergenic
1184755157 22:46511713-46511735 CTGAAGGCCAACAGTGGGGAAGG + Intronic
1184907375 22:47497892-47497914 GGGCAGGGCCTGAGTGGGGAGGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185182259 22:49370126-49370148 CCGCATGGCCAGGGTGAGGAAGG + Intergenic
1185322620 22:50208955-50208977 CTGCAGGGCCAGCTTGGGGCGGG + Intronic
1185344915 22:50306936-50306958 CTGCAGGAGCAGGGTGCGGAGGG + Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
949147885 3:725565-725587 CTGCAAGGGCAGAGTGAAGAGGG - Intergenic
949563247 3:5221830-5221852 ACACAGAGCCAGAGTGGGGAGGG - Intergenic
950429074 3:12940645-12940667 TTGCAGGGGCAGGCTGGGGAGGG - Intronic
950702799 3:14761718-14761740 CTGAAGGGATGGAGTGGGGAGGG + Intronic
950869839 3:16219252-16219274 CTCCAGGGCTGCAGTGGGGAGGG - Intronic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
951637319 3:24793939-24793961 CTGCAGAGCCACGGTGGTGATGG - Intergenic
952914424 3:38222477-38222499 CTGCAAGAGCAGAGTGGGGAGGG + Intronic
953018597 3:39099971-39099993 CTTCAGAGCCACAGTTGGGATGG - Intronic
953019136 3:39102989-39103011 CAGCAGGGTCACTGTGGGGATGG + Intronic
953044168 3:39280736-39280758 CTGCAGGGCAAGAGTGGCAGGGG - Intronic
953540898 3:43817219-43817241 GAGCAGGGCCAGGGTGGGGAAGG + Intergenic
953842154 3:46397525-46397547 CTGCAAGGCCAGACAGGGCAAGG + Intergenic
954160160 3:48715599-48715621 ATGCAGGGCCTGGGTAGGGAGGG - Intronic
954619088 3:51985632-51985654 GTTCTGGGCCAGAGTGGGGTGGG + Intronic
954685627 3:52368718-52368740 CTGCAGCGCCAGGGAGGAGAGGG - Intronic
954873673 3:53786718-53786740 GGGCAGGGGCAGAGTGGGGCGGG - Intronic
960036137 3:113104877-113104899 CCAGAGGGCCAGAGCGGGGAGGG - Intergenic
960319895 3:116221736-116221758 CTCCAGGGCGAGAGTGAGGATGG - Intronic
960651335 3:119953847-119953869 CTGCAGGGAGAGATTGGTGATGG - Intronic
961173775 3:124817556-124817578 CTGCAGGGCCTCAGTGGGAGAGG + Intronic
961329728 3:126131447-126131469 CTTCAGGGCCAGCGTGTAGACGG + Exonic
961353028 3:126316197-126316219 GTGCACGGGCGGAGTGGGGAAGG + Intergenic
961520853 3:127466653-127466675 CTGCAGGGGCAGAGGGGTGCAGG + Intergenic
961670441 3:128524514-128524536 CTGGAGGGACTCAGTGGGGAGGG - Intergenic
961805713 3:129487933-129487955 TTCCAGAGGCAGAGTGGGGAGGG + Intronic
962096441 3:132297506-132297528 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
964943045 3:162185123-162185145 CTGTGAGGCCATAGTGGGGATGG - Intergenic
965179128 3:165378560-165378582 CTACAGAGGCTGAGTGGGGAGGG + Intergenic
965722598 3:171678060-171678082 TTTCAGGGGCAGAGTGGGAAGGG + Intronic
966554661 3:181245361-181245383 CACCGGGGCCAGTGTGGGGATGG + Intergenic
966912283 3:184566235-184566257 TGGCAGGGCCACAGTGGGGTGGG + Intronic
967214480 3:187198931-187198953 CTGTGGGGGCTGAGTGGGGAGGG + Intronic
967423668 3:189301689-189301711 CTCCAGGCCAAGAGTGGGGCTGG - Intronic
968058583 3:195711660-195711682 CTGCTGGCTCAGGGTGGGGAAGG - Intergenic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968547989 4:1208288-1208310 GTGCAGGGCCAGCCTGGGGTGGG + Intronic
968552676 4:1231733-1231755 ATGCAGGCCCAGGGTGGGGCTGG + Intronic
968983911 4:3865244-3865266 CGGCCGTGCCAGCGTGGGGAGGG + Intergenic
969098434 4:4751535-4751557 CAGCAGGGCCAGACAGGCGAAGG - Intergenic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969943006 4:10753709-10753731 GAGCAGGGACAGAGTTGGGATGG - Intergenic
970423954 4:15929573-15929595 AGGCAGGGCAAGGGTGGGGAGGG - Intergenic
971372418 4:26029307-26029329 CAGCAGGGCCAGCCTGGGGAGGG - Intergenic
971876946 4:32319351-32319373 CTGCTGCGCCAGGGTGGGCATGG + Intergenic
973176548 4:47212848-47212870 CTGCAGGTTCAGACTAGGGAGGG - Intronic
973258835 4:48140447-48140469 ATGCAGGGCAAGAGTGAGGGTGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
975032962 4:69645920-69645942 CTGCAAGGTAAGAATGGGGAAGG - Intronic
977290317 4:95158964-95158986 CTGATGGGCCAGAGGAGGGAAGG + Intergenic
977515420 4:98016042-98016064 CTCCAGGGCCTGTGTGGGGGTGG + Intronic
977983973 4:103360377-103360399 CTGCAGGGGCAGAGTGCTCATGG + Intergenic
978658972 4:111100354-111100376 CTGCAAGGCCACAGTGAGGCTGG - Intergenic
979078170 4:116300911-116300933 CTGCACCTCCAGAGTGGGGAAGG - Intergenic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981658290 4:147137192-147137214 CAGGATGGCCACAGTGGGGATGG - Intergenic
982116856 4:152105204-152105226 CTGCAGAGCCAGGCTGGGGCCGG + Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982258271 4:153470903-153470925 CTGCAGGGCAGGAGTCAGGAAGG - Intronic
982411905 4:155087041-155087063 CTGCAGGGCTTGAGTGTGCATGG + Intergenic
984943036 4:184950982-184951004 CCAGAGGGCCAGAGTGGTGACGG + Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
985643591 5:1074811-1074833 CTTCAGGGCAAGGGTGGGCATGG - Intronic
985692405 5:1320732-1320754 CTGCAGGGCCAGACGGGAGGAGG + Intronic
985708389 5:1414483-1414505 CTGGAGGGTCAGGGCGGGGAAGG + Intronic
985778830 5:1859049-1859071 CTGCAGGGCCACAGGGTTGAGGG - Intergenic
985864509 5:2503750-2503772 GTGCAGGGCCAGCCTGTGGAGGG + Intergenic
985923899 5:3000731-3000753 ATGTAGGGCACGAGTGGGGAAGG + Intergenic
985963259 5:3319849-3319871 CTGGAGGCCCACAGTGGGGGCGG - Intergenic
986284443 5:6349094-6349116 CTGCAGGGCAGGACTGGGGCTGG - Intergenic
986353305 5:6900667-6900689 CTGCAGGGCTGGAGTGCGGAGGG + Intergenic
987172274 5:15271121-15271143 CTGCAGAGCTAGAGTGAGAAAGG - Intergenic
988275587 5:29077686-29077708 CTGCTGGGCCTCAGTGGAGATGG - Intergenic
989779761 5:45249939-45249961 CTGCAGGGGGAAAGTGGGGATGG - Intergenic
990165471 5:52989217-52989239 CCGCAGGGCCGGGGTGGGGCGGG + Intergenic
990566763 5:57037506-57037528 CTGCAAGGCCAGAGAAGGGAGGG + Intergenic
993092339 5:83441848-83441870 ATGCAGGTTCAGACTGGGGATGG - Intergenic
993611641 5:90061457-90061479 CATCAGGGGCAGAGTGGTGATGG + Intergenic
993993351 5:94687369-94687391 CTCCAGGGGCAGTGGGGGGAAGG + Intronic
995189892 5:109309043-109309065 CTGGAGTGCCAGGATGGGGATGG + Intergenic
996286186 5:121795756-121795778 CTGCAGGAGCACAGTGGGGGAGG + Intergenic
996698470 5:126424124-126424146 CTTCAAGAGCAGAGTGGGGATGG + Intronic
997938993 5:138139414-138139436 CTGAAGCCCCAGCGTGGGGACGG + Exonic
998464769 5:142334725-142334747 CTGAAGGGGCAGTGTGGGGATGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999380358 5:151117164-151117186 CTGCAGGGGCATCGTGAGGAGGG - Exonic
999731940 5:154481727-154481749 CTGCAGGGGCAGTGTGGGCTAGG - Intergenic
1001419010 5:171572880-171572902 CTGCAGGTCCAGAGGAGGCATGG - Intergenic
1002278211 5:178116400-178116422 CAGGAGGGGCACAGTGGGGACGG + Intronic
1002306857 5:178288602-178288624 ATGCCTGGCCAGCGTGGGGAGGG - Intronic
1002998799 6:2311887-2311909 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1003053353 6:2798910-2798932 CAGCAGGGCTAGTGTGGGGGCGG + Intergenic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1004403503 6:15310644-15310666 CTGCAGGTGCAGAGATGGGATGG + Intronic
1006093668 6:31642910-31642932 CTGCAGGGCCAGGGGCTGGAGGG - Exonic
1006151870 6:31994169-31994191 CTTCAGGGCCACAGGAGGGAGGG - Intronic
1006158171 6:32026907-32026929 CTTCAGGGCCACAGGAGGGAGGG - Intronic
1006359271 6:33578543-33578565 CTGCAAGGCAGCAGTGGGGAAGG - Intronic
1006453656 6:34120004-34120026 CTCCAGGGCCAGGCTGGGGTTGG + Intronic
1006467181 6:34202764-34202786 CTGCAGGGACAGAAAGGGGGTGG + Intergenic
1006514284 6:34537500-34537522 ATGCAGGACCGGAGTGGGGAAGG - Intergenic
1007027306 6:38589415-38589437 ATGCAGGGCAAGAGAGGGAAAGG + Intronic
1007282455 6:40722571-40722593 AGGCAGTCCCAGAGTGGGGAGGG + Intergenic
1007696414 6:43736872-43736894 CTGGAAGGCCACAGTGGGGAAGG - Intergenic
1008366170 6:50683057-50683079 ATACTGGGCCAGAGTGGTGAGGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1013281837 6:108645057-108645079 CATCAGGGCCAGAGTGGTGGTGG - Intronic
1013374050 6:109496979-109497001 GGGCAGGGTCAGAGTGTGGAAGG - Intronic
1014251716 6:119122187-119122209 CTGGAGGTCCAGAATGGAGAGGG - Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1014797895 6:125747798-125747820 TTGCGGGGCCGGAGCGGGGACGG + Intronic
1016247052 6:141995059-141995081 CTGCAGAGCCAGAGTTTGGCTGG - Intergenic
1016573977 6:145547038-145547060 CTACAGGGCAAGAATGGAGAAGG - Intronic
1016806204 6:148214931-148214953 CTACAGGGCCAGGGCAGGGATGG - Intergenic
1016841924 6:148533517-148533539 CTGCAGGGCAGGAGGGTGGAGGG + Intronic
1017001505 6:150000449-150000471 CCCCAGGGCCAGGGAGGGGAGGG + Intergenic
1017643475 6:156516731-156516753 GGGCAGGGGCAGGGTGGGGAAGG - Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018608081 6:165620276-165620298 CTGCCTGGCCAGGGTGGGGGTGG - Intronic
1018688634 6:166324399-166324421 CTGCAGGGTCAGAGGAGGGGAGG - Intronic
1019014168 6:168867646-168867668 CTGCAGGGGTAGCATGGGGACGG + Intergenic
1019216916 6:170449962-170449984 AAGCAGGGCCATGGTGGGGAAGG + Intergenic
1019416761 7:931192-931214 CTGCCTGGCCAGGGTGGGGACGG + Intronic
1019577705 7:1745510-1745532 CTGCGTGGCCAGCGTGGGCAGGG - Exonic
1019867981 7:3730827-3730849 CTTCAAGGCCAGAGTGTGGTAGG - Intronic
1020007962 7:4792309-4792331 GGGCGGAGCCAGAGTGGGGAGGG - Intronic
1023587384 7:41744695-41744717 CTGCAGGGGCCCAGTGGAGAGGG - Intergenic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1023843670 7:44109651-44109673 CTGCAGGGCCATTGTGCAGACGG + Intronic
1023876747 7:44290351-44290373 CTGGAGGACCTGAGCGGGGAGGG - Intronic
1024261001 7:47573689-47573711 CTGCAGGCCCAGAGACGGGGTGG - Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1026202426 7:68225931-68225953 CTGTAGGTCTAGAGTGGGCAGGG + Intergenic
1026906026 7:74063239-74063261 CAGGAGGGGCAGGGTGGGGAGGG + Intronic
1026981530 7:74529618-74529640 CTACATGGCCAGAGTGGAGTGGG + Intronic
1028449486 7:90965163-90965185 ATGCAGAGACAAAGTGGGGATGG - Intronic
1029379538 7:100203998-100204020 CTGAGGGGAAAGAGTGGGGAAGG - Intronic
1029692740 7:102193048-102193070 CTGCAGCCCCAGGTTGGGGAAGG - Intronic
1030451588 7:109719534-109719556 CTGCAAGGCCACAGTGAGGATGG + Intergenic
1031993009 7:128210114-128210136 GTGCAGAGCCTGAGAGGGGAAGG + Intergenic
1032071510 7:128810436-128810458 CCGAAGGGTCAGAGTTGGGAAGG + Intronic
1032472299 7:132187428-132187450 CTGCAGCACCAGAGAGGGAAAGG - Intronic
1033710318 7:143936012-143936034 CTGAGGGACCAGAGTGGGGCTGG - Exonic
1034294727 7:149962338-149962360 ATGCAGGGCCAGATTGTGCAAGG + Intergenic
1034301317 7:150017683-150017705 CTGGTGGGCCAGGGTTGGGAGGG - Intergenic
1034350589 7:150412353-150412375 CTGCAGAGCCGGGGTGGGGGTGG - Intronic
1034804734 7:154079615-154079637 CTGGTGGGCCAGGGTTGGGAGGG + Intronic
1034811337 7:154134614-154134636 ATGCAGGGCCAGATTGTGCAAGG - Intronic
1035256685 7:157633662-157633684 GGGCAGGGCCTGAGTGGGGGTGG + Intronic
1035567970 8:654387-654409 CTGGAGGGGCAGAGCTGGGACGG + Intronic
1035627034 8:1078139-1078161 CTGGAGGGCCAGCGTGTTGAGGG - Intergenic
1036448887 8:8847696-8847718 CTGAAGGTCCAGAGTGTGCAGGG - Intronic
1036612333 8:10361074-10361096 CTGCAGAGCCTGAGAGGGCATGG - Intronic
1036616853 8:10394706-10394728 CTGCTGGGGCAGAGTGCAGAAGG - Intronic
1036662303 8:10716178-10716200 CTGCTGGGACAGGGCGGGGAAGG + Intergenic
1036936245 8:13004825-13004847 CAGCTCGGCCACAGTGGGGAAGG + Intronic
1037098892 8:15018625-15018647 ATGCAGGGACAGAGGGGAGAAGG + Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1041007608 8:53510394-53510416 ATGCAGAGCCAGAGTGCTGAAGG - Intergenic
1042544198 8:69936156-69936178 TTGGAAGGTCAGAGTGGGGATGG - Intergenic
1044108437 8:88240444-88240466 CAGCAAGGACAGAGTGGAGAGGG + Intronic
1044242090 8:89900345-89900367 ATTAAGGGGCAGAGTGGGGATGG + Intergenic
1044625769 8:94234281-94234303 CTGAAGCGCCAGAGGGCGGATGG - Intergenic
1045497106 8:102718104-102718126 GTGCAGGGGGAGAGTGGGAAGGG - Intergenic
1048271885 8:133035947-133035969 CTGCAGGGCCCTAGAGGGTAGGG - Intronic
1048280322 8:133101068-133101090 TTGCAGGGCAGGAGTGGGGAGGG + Intronic
1048843817 8:138587988-138588010 ATGCAGGATCACAGTGGGGAGGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049179309 8:141212899-141212921 CAGCAGGGGCTGAGTGGGGAGGG + Intronic
1049206416 8:141365687-141365709 ATGAAGGGCCAGAGGTGGGAAGG + Intronic
1049262121 8:141645517-141645539 CTGCAGGGAGGGAGTGGGGAGGG - Intergenic
1049351209 8:142165748-142165770 CGGCAGGGCCAGCCTGGGGCTGG - Intergenic
1049552524 8:143267164-143267186 GTGCAGGGCCGGCGTCGGGAAGG + Intronic
1049658737 8:143810309-143810331 CTGCAGGGCCAGCTGGGTGAAGG - Intronic
1049694787 8:143977831-143977853 CTGCAGGGCGAGACGGGGCAAGG + Intronic
1049778466 8:144416875-144416897 GTCCAGGGCCAGACTGGGGCTGG + Exonic
1052508395 9:29383178-29383200 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1052512326 9:29437803-29437825 CTGCAGGGCCAGAGAGGTAAAGG - Intergenic
1052833632 9:33234571-33234593 GTGCAGGCCCAAAGAGGGGAAGG + Intronic
1053018092 9:34675531-34675553 CTGCAGTCCCAGAGTGTGGGTGG + Intergenic
1053752017 9:41266625-41266647 CTGCAGGATCTGGGTGGGGAAGG - Intergenic
1054257538 9:62830955-62830977 CTGCAGGATCTGGGTGGGGAAGG - Intergenic
1054333775 9:63784767-63784789 CTGCAGGATCTGGGTGGGGAAGG + Intergenic
1055814172 9:80185548-80185570 CTGCCGGGCCCGGGTGGTGAGGG - Intergenic
1056131168 9:83588078-83588100 CTGAAAGGCTAGGGTGGGGATGG - Intergenic
1056228076 9:84516125-84516147 ATTCAGGGCAAGGGTGGGGAGGG + Intergenic
1056634540 9:88320658-88320680 CTGTAGGTCCAGAGTTGGGCAGG - Intergenic
1056752817 9:89364281-89364303 CAGCAGGGCCATGGTGGGGTGGG - Intronic
1056877922 9:90353212-90353234 CTGCAGGGTGGGAGTAGGGAGGG + Intergenic
1056899123 9:90582442-90582464 CTGCAGGGCCAGAGAGGCCGCGG + Intergenic
1057210529 9:93198795-93198817 CAGCAGGGCCAGAGCTGGGCAGG - Intronic
1057470368 9:95351091-95351113 CTGGAGGGCAGGTGTGGGGAAGG - Intergenic
1059457021 9:114406225-114406247 GCTCAGGGCCAGAGTGGCGAAGG - Intronic
1059578824 9:115521437-115521459 GTGCAGGGCCAGATTGTGAATGG + Intergenic
1059672161 9:116501968-116501990 CTCCAGGGATGGAGTGGGGAGGG - Intronic
1059684865 9:116625448-116625470 CAATGGGGCCAGAGTGGGGAGGG - Intronic
1060055321 9:120408233-120408255 CCACAAGGCCAGAGTGGAGAGGG + Intronic
1060104699 9:120866299-120866321 CTTCAGGGCAAGATTTGGGAAGG - Intronic
1060529459 9:124339844-124339866 CTGCAGGGCCAGGCTGGTGGAGG + Intronic
1060558465 9:124522710-124522732 CTGCAAGACCAGTGTGGGCAAGG - Exonic
1060732703 9:126048350-126048372 CTGCAGAGGCACAGAGGGGAGGG + Intergenic
1060948650 9:127586566-127586588 CTGCAGGTCCAGGGAGCGGATGG - Intergenic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061745979 9:132740716-132740738 ATGCAGCCCCAGAGTGGGGCGGG - Intronic
1062004644 9:134233120-134233142 GAGCAGGGCCAGAGTCGGCATGG - Intergenic
1062216862 9:135393984-135394006 CTGCAGGGGCAGGGCTGGGACGG - Intergenic
1062291745 9:135798424-135798446 CTGCAGGGCCCGAGCAGGGCGGG - Intergenic
1062522520 9:136964155-136964177 CTCCAGGGCCAGGGTGGGCACGG - Intergenic
1062527409 9:136983546-136983568 CTGCAGGGCAAGTGCAGGGAAGG - Exonic
1062547626 9:137070748-137070770 CTGCGAGGCCAGAGTGGAGCAGG - Intergenic
1062627405 9:137449540-137449562 CTGCGGGGCCACGGTGGGGTGGG - Intronic
1062733062 9:138120196-138120218 CCGCTGGGCCAGCGTGGAGATGG - Exonic
1203492339 Un_GL000224v1:118981-119003 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1203504962 Un_KI270741v1:60853-60875 CTGCAGGAGCTGGGTGGGGAAGG + Intergenic
1186195870 X:7110030-7110052 CTGCAAGGGCAGCATGGGGAGGG + Intronic
1187447695 X:19373206-19373228 ATGCAGGGACAGAGGGGGCAAGG + Intronic
1187777269 X:22775380-22775402 CTGCAAGACTAGAGTGGAGAGGG - Intergenic
1188112801 X:26212084-26212106 CTGCATGGCTACTGTGGGGAAGG + Intergenic
1188138088 X:26514564-26514586 GTGCAGGGCCACCTTGGGGAGGG - Intergenic
1188907253 X:35803301-35803323 ATGCAGGTCCAGGGTGGGGCTGG + Exonic
1189740177 X:44109609-44109631 TTGCAGGGCCAGGGTGGGGAGGG + Intergenic
1190060197 X:47205909-47205931 GTGCAGTTCCAGGGTGGGGATGG - Intronic
1190730806 X:53224512-53224534 CTGAAGGGCCGGGGTGGGGGTGG + Intronic
1190771555 X:53518958-53518980 CTGTACAGCAAGAGTGGGGAAGG + Intergenic
1192185127 X:68941591-68941613 CTGCAGGGCGGGGGTGGGGTGGG - Intergenic
1192452641 X:71253489-71253511 CTGCCTGGCCAGTGTGGGCACGG - Intronic
1193352939 X:80483075-80483097 CTGAAAGGGCAGACTGGGGAGGG + Intergenic
1194636959 X:96357697-96357719 CTGCATGGGCAGGGTGGGAAGGG - Intergenic
1195570837 X:106397001-106397023 CTGCAGGCACCGAGTGGAGAGGG + Intergenic
1195659110 X:107360999-107361021 CTGGATGGCAAGGGTGGGGAGGG - Intergenic
1195674793 X:107499863-107499885 AGGCAGGCCCAGAGTTGGGAGGG - Intergenic
1196459747 X:115917916-115917938 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1197415378 X:126166435-126166457 CTGCAGGGGCAGAGTCGCGGAGG + Intergenic
1197896140 X:131317592-131317614 TAGCAGGCCAAGAGTGGGGAAGG - Intronic
1198028411 X:132731370-132731392 CCTGAGGGCCAGAGTGGAGATGG + Intronic
1198038110 X:132821565-132821587 TTGGAGGGCCTGGGTGGGGAGGG - Intronic
1198832329 X:140764336-140764358 CTGCAGAGACGGAGTGGGGCGGG + Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1199718529 X:150525155-150525177 GTGCAGGGCCGGGGCGGGGAAGG - Intergenic
1199755049 X:150855997-150856019 GGTCAGGGCCAGACTGGGGAGGG - Intronic
1200121086 X:153790923-153790945 CTGCCTGGGCACAGTGGGGACGG - Intronic
1200235790 X:154467166-154467188 CTGCAGGGTCGGGGTGGGGCGGG - Intronic
1201259836 Y:12148176-12148198 CTGTATAGCAAGAGTGGGGAAGG - Intergenic