ID: 999193767

View in Genome Browser
Species Human (GRCh38)
Location 5:149768060-149768082
Sequence AACAAGATTACGGAGGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 2, 2: 10, 3: 22, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999193767_999193771 14 Left 999193767 5:149768060-149768082 CCAGTCTCCTCCGTAATCTTGTT 0: 1
1: 2
2: 10
3: 22
4: 150
Right 999193771 5:149768097-149768119 TGCAGAAAACCCTGCTTCACAGG No data
999193767_999193772 15 Left 999193767 5:149768060-149768082 CCAGTCTCCTCCGTAATCTTGTT 0: 1
1: 2
2: 10
3: 22
4: 150
Right 999193772 5:149768098-149768120 GCAGAAAACCCTGCTTCACAGGG 0: 3
1: 1
2: 2
3: 19
4: 243
999193767_999193776 27 Left 999193767 5:149768060-149768082 CCAGTCTCCTCCGTAATCTTGTT 0: 1
1: 2
2: 10
3: 22
4: 150
Right 999193776 5:149768110-149768132 GCTTCACAGGGATAGGATGTTGG 0: 1
1: 1
2: 22
3: 42
4: 181
999193767_999193773 20 Left 999193767 5:149768060-149768082 CCAGTCTCCTCCGTAATCTTGTT 0: 1
1: 2
2: 10
3: 22
4: 150
Right 999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999193767 Original CRISPR AACAAGATTACGGAGGAGAC TGG (reversed) Intronic