ID: 999193769

View in Genome Browser
Species Human (GRCh38)
Location 5:149768067-149768089
Sequence CAACCAAAACAAGATTACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999193769_999193773 13 Left 999193769 5:149768067-149768089 CCTCCGTAATCTTGTTTTGGTTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG No data
999193769_999193771 7 Left 999193769 5:149768067-149768089 CCTCCGTAATCTTGTTTTGGTTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 999193771 5:149768097-149768119 TGCAGAAAACCCTGCTTCACAGG No data
999193769_999193772 8 Left 999193769 5:149768067-149768089 CCTCCGTAATCTTGTTTTGGTTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 999193772 5:149768098-149768120 GCAGAAAACCCTGCTTCACAGGG 0: 3
1: 1
2: 2
3: 19
4: 243
999193769_999193776 20 Left 999193769 5:149768067-149768089 CCTCCGTAATCTTGTTTTGGTTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 999193776 5:149768110-149768132 GCTTCACAGGGATAGGATGTTGG 0: 1
1: 1
2: 22
3: 42
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999193769 Original CRISPR CAACCAAAACAAGATTACGG AGG (reversed) Intronic