ID: 999193770

View in Genome Browser
Species Human (GRCh38)
Location 5:149768070-149768092
Sequence CAGCAACCAAAACAAGATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 6, 1: 8, 2: 20, 3: 28, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999193770_999193776 17 Left 999193770 5:149768070-149768092 CCGTAATCTTGTTTTGGTTGCTG 0: 6
1: 8
2: 20
3: 28
4: 226
Right 999193776 5:149768110-149768132 GCTTCACAGGGATAGGATGTTGG 0: 1
1: 1
2: 22
3: 42
4: 181
999193770_999193772 5 Left 999193770 5:149768070-149768092 CCGTAATCTTGTTTTGGTTGCTG 0: 6
1: 8
2: 20
3: 28
4: 226
Right 999193772 5:149768098-149768120 GCAGAAAACCCTGCTTCACAGGG 0: 3
1: 1
2: 2
3: 19
4: 243
999193770_999193771 4 Left 999193770 5:149768070-149768092 CCGTAATCTTGTTTTGGTTGCTG 0: 6
1: 8
2: 20
3: 28
4: 226
Right 999193771 5:149768097-149768119 TGCAGAAAACCCTGCTTCACAGG No data
999193770_999193777 30 Left 999193770 5:149768070-149768092 CCGTAATCTTGTTTTGGTTGCTG 0: 6
1: 8
2: 20
3: 28
4: 226
Right 999193777 5:149768123-149768145 AGGATGTTGGAAATAGAAGCAGG 0: 2
1: 25
2: 33
3: 51
4: 318
999193770_999193773 10 Left 999193770 5:149768070-149768092 CCGTAATCTTGTTTTGGTTGCTG 0: 6
1: 8
2: 20
3: 28
4: 226
Right 999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999193770 Original CRISPR CAGCAACCAAAACAAGATTA CGG (reversed) Intronic