ID: 999193773

View in Genome Browser
Species Human (GRCh38)
Location 5:149768103-149768125
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999193770_999193773 10 Left 999193770 5:149768070-149768092 CCGTAATCTTGTTTTGGTTGCTG 0: 6
1: 8
2: 20
3: 28
4: 226
Right 999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG No data
999193767_999193773 20 Left 999193767 5:149768060-149768082 CCAGTCTCCTCCGTAATCTTGTT 0: 1
1: 2
2: 10
3: 22
4: 150
Right 999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG No data
999193769_999193773 13 Left 999193769 5:149768067-149768089 CCTCCGTAATCTTGTTTTGGTTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type