ID: 999194826

View in Genome Browser
Species Human (GRCh38)
Location 5:149774764-149774786
Sequence TGCAGAACTCCATTTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999194823_999194826 -3 Left 999194823 5:149774744-149774766 CCTCTGGCCCTATACTGACTTGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194824_999194826 -10 Left 999194824 5:149774751-149774773 CCCTATACTGACTTGCAGAACTC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194820_999194826 5 Left 999194820 5:149774736-149774758 CCCTCCTGCCTCTGGCCCTATAC 0: 1
1: 0
2: 3
3: 33
4: 356
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194818_999194826 11 Left 999194818 5:149774730-149774752 CCCTCTCCCTCCTGCCTCTGGCC 0: 1
1: 1
2: 13
3: 188
4: 1624
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194822_999194826 1 Left 999194822 5:149774740-149774762 CCTGCCTCTGGCCCTATACTGAC 0: 1
1: 0
2: 2
3: 13
4: 147
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194813_999194826 24 Left 999194813 5:149774717-149774739 CCTGAACCTCACCCCCTCTCCCT 0: 1
1: 0
2: 1
3: 52
4: 700
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194819_999194826 10 Left 999194819 5:149774731-149774753 CCTCTCCCTCCTGCCTCTGGCCC 0: 1
1: 0
2: 20
3: 256
4: 1817
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194814_999194826 18 Left 999194814 5:149774723-149774745 CCTCACCCCCTCTCCCTCCTGCC 0: 1
1: 2
2: 31
3: 405
4: 3487
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194821_999194826 4 Left 999194821 5:149774737-149774759 CCTCCTGCCTCTGGCCCTATACT 0: 1
1: 0
2: 0
3: 23
4: 342
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194815_999194826 13 Left 999194815 5:149774728-149774750 CCCCCTCTCCCTCCTGCCTCTGG 0: 1
1: 1
2: 22
3: 247
4: 1729
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102
999194817_999194826 12 Left 999194817 5:149774729-149774751 CCCCTCTCCCTCCTGCCTCTGGC 0: 1
1: 1
2: 28
3: 249
4: 1727
Right 999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999194826 Original CRISPR TGCAGAACTCCATTTGTAGC TGG Intronic
913177719 1:116290305-116290327 TGGAGAACTCCATTGTCAGCTGG - Intergenic
915477559 1:156161897-156161919 TGCAGAGCTAAATTTGTGGCTGG - Intronic
916808141 1:168280270-168280292 TTCACAGCTCCATTTGTAGGAGG + Intergenic
919012742 1:191986300-191986322 TGCAGTATTCCATTTGTGGCTGG - Intergenic
919614452 1:199787870-199787892 TTGAAAACTCCATTTGTGGCCGG - Intergenic
920689560 1:208135481-208135503 TGCAGGAATCCATCAGTAGCAGG - Intronic
921862714 1:220056005-220056027 TAGAGAACTCCATTCGTAGAGGG + Intergenic
921986381 1:221317313-221317335 TGCAGCTCTCCATTTTCAGCTGG - Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
924193088 1:241576780-241576802 TGCATATCTCAATCTGTAGCAGG + Intronic
924501166 1:244639387-244639409 CACAGAACTTCATTTCTAGCTGG + Intronic
1062859057 10:795591-795613 TGTCGAGCTCCCTTTGTAGCAGG - Intergenic
1063782906 10:9347361-9347383 TGAAGAACTTCATTTCTTGCAGG + Intergenic
1067660947 10:48235826-48235848 TGCAGAGCCCCATGTGTGGCTGG - Intronic
1068671307 10:59726512-59726534 TACATAACTCCTTTTGTAGCAGG + Intronic
1069800090 10:71076605-71076627 TGCAGAGCTCTGTGTGTAGCTGG - Intergenic
1074061451 10:109969822-109969844 TGCAGTACACCATTTGTCACGGG - Intergenic
1075990497 10:126834361-126834383 TGCTTAACTCCATATGTAGCAGG + Intergenic
1079709123 11:23659049-23659071 TCCAGGGCTCCACTTGTAGCTGG - Intergenic
1079741527 11:24068152-24068174 CTCAAAACTCCATTTGTACCTGG + Intergenic
1085365601 11:75940090-75940112 TGCATAACTCTAAATGTAGCAGG + Intronic
1089759366 11:120711751-120711773 TGCAGAAGGCCTTTTGTGGCTGG + Intronic
1090301220 11:125641350-125641372 TGGAGAACTCCAATAGTAGGAGG - Intronic
1090561770 11:127940137-127940159 TGCAGAACTTCATTTTCAGAAGG + Intergenic
1093338503 12:17940234-17940256 TGCATAACACTATCTGTAGCGGG - Intergenic
1095407395 12:41881934-41881956 TGGAGATCTCTATTTGCAGCTGG + Intergenic
1100403835 12:94255580-94255602 TGTAGAACTGAATGTGTAGCTGG + Intronic
1104382232 12:128317165-128317187 TACAGAACTGCATTTGGTGCAGG - Intronic
1106137971 13:26988835-26988857 TGGAGCACTTCATATGTAGCAGG - Intergenic
1109451781 13:62524486-62524508 AGCAGAAGTCTATTTGTAGCTGG - Intergenic
1110741933 13:79007905-79007927 TCCAGGACTCCAGTTGCAGCTGG + Intergenic
1112668539 13:101607400-101607422 TGCAGAATTATATTTGTAACAGG - Intronic
1113916868 13:113879245-113879267 TGCGGGACTCCATTTGTTCCGGG - Intergenic
1117102177 14:52361021-52361043 AGCTGAACTCCATTTGTAGAGGG + Intergenic
1118417187 14:65553515-65553537 TGCAGATCTGCATTTTTATCTGG + Intronic
1128456095 15:67832293-67832315 TGCGGAGCTCCATTTGTTCCAGG - Exonic
1128663226 15:69518238-69518260 TGCCAAACTCCAATTATAGCTGG + Intergenic
1132224046 15:100126967-100126989 AGCAGCACCCCATTTGAAGCAGG + Intronic
1135232411 16:20721520-20721542 TCCAGCACTACAGTTGTAGCAGG - Intronic
1140565059 16:76032053-76032075 TGCAGAGCTGCATTTGTTTCTGG - Intergenic
1143724452 17:8835805-8835827 TTCAGAACTCCAGTTCTGGCAGG - Intronic
1147539847 17:41348156-41348178 TCCAATTCTCCATTTGTAGCTGG - Intronic
1149068161 17:52505328-52505350 TGCTGCCCTCCATTTATAGCTGG + Intergenic
1150967544 17:69988923-69988945 AGTTGTACTCCATTTGTAGCTGG - Intergenic
1151710101 17:75799534-75799556 TGCAGAGCTGCTTTTGTACCAGG + Intronic
1153317624 18:3740530-3740552 TTCAGGACTCCATTTAGAGCAGG + Intronic
1157161180 18:45315779-45315801 TCCTGAAGTTCATTTGTAGCTGG + Intronic
1157485176 18:48081689-48081711 TGCAGAACTTAATTTGATGCTGG - Intronic
1160987213 19:1844606-1844628 TCCAGAACTGCATCTGTAGAGGG - Intronic
927509001 2:23632625-23632647 AGCAGAAGTGCATTTGTTGCGGG - Intronic
930545551 2:52762418-52762440 TGTAGCCCTCCACTTGTAGCTGG - Intergenic
935891500 2:107683751-107683773 TGCATAACTCTATTAGGAGCAGG + Intergenic
937234304 2:120421285-120421307 TGCAGATCTTCATCTGTGGCTGG - Intergenic
939882164 2:147642792-147642814 TGCAAAACTCTTTTTGTAGGAGG + Intergenic
942178405 2:173355933-173355955 TGAAGAAAACCATGTGTAGCTGG + Intronic
942600253 2:177633840-177633862 TGGAGAAATGCTTTTGTAGCAGG - Intronic
946896510 2:224329554-224329576 TGCAAAACTCCACCTGTAGGAGG - Intergenic
947113025 2:226740050-226740072 TGCAAAAATTCATTTGTAACAGG + Intronic
1171030020 20:21668926-21668948 TGCAGATCTCCCTATGGAGCTGG - Intergenic
1175321897 20:58094213-58094235 TGGAGATCTCCATTTCTAGCAGG + Intergenic
1175696170 20:61104863-61104885 TGCAGGACTATATTTCTAGCAGG + Intergenic
1178269431 21:31176271-31176293 TGCAGAACTGTATTTGTATGAGG - Intronic
1179234879 21:39536785-39536807 TTCAGACCTCCATTTATTGCAGG - Intergenic
1183075273 22:35422871-35422893 AGCAGGACTCCTTTTGTTGCTGG - Intronic
949395415 3:3609794-3609816 TGCAAAACTCCATCACTAGCTGG + Intergenic
949905059 3:8852353-8852375 TGCAGAACTCCCTTTGCACCTGG + Intronic
950199110 3:11030252-11030274 AGCAGAACTACATTTGGATCTGG - Intronic
964290611 3:155176179-155176201 TTCAGAAGTCCAATTGTAGTAGG + Intronic
966231612 3:177658616-177658638 TGCAGAACTCCACATGCTGCAGG - Intergenic
969906474 4:10401329-10401351 TGCAGAAGTCTATTTGTAATTGG - Intergenic
970404850 4:15753306-15753328 TTCAGAAGTCCATTTGTGGGAGG + Intergenic
976592951 4:86867591-86867613 TGAAGAAAGTCATTTGTAGCTGG - Intergenic
979685500 4:123506743-123506765 TGGAGGACTCCACTTGCAGCGGG + Intergenic
979772609 4:124547252-124547274 TACAGAACTTCAATTGTAGGGGG + Intergenic
980973941 4:139592887-139592909 GCCAGAACTGTATTTGTAGCAGG + Intronic
988735412 5:34015610-34015632 GGCAAAACTCCATTTGTTGAGGG - Intronic
991031278 5:62084923-62084945 TACAGAGCTCCATTTGGAACAGG + Intergenic
993928398 5:93902048-93902070 TGCAGAACTTCAAGTGTAGTAGG + Intronic
994077562 5:95670415-95670437 TGAAAAAATGCATTTGTAGCTGG - Intronic
995413830 5:111887498-111887520 TGCTGAAGTCCATTTGGAGAAGG + Intronic
996955597 5:129179637-129179659 CCCAGATGTCCATTTGTAGCGGG + Intergenic
999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG + Intronic
1007193422 6:40039138-40039160 TGCAGATCCCCATTTGCAGCTGG + Intergenic
1008947298 6:57112284-57112306 TGAAGTAATCCATTTGTTGCAGG + Intronic
1015551028 6:134412672-134412694 TGCAGAACTATATTTTTTGCAGG + Intergenic
1017560382 6:155621354-155621376 TGCAGCACTCCATTTATACATGG + Intergenic
1020059739 7:5143514-5143536 TGAAGTACTGCATTTGCAGCTGG + Intergenic
1020168232 7:5824233-5824255 TGAAGTACTGCATTTGCAGCTGG - Intergenic
1020210580 7:6154957-6154979 GACAGAACTGCACTTGTAGCCGG + Exonic
1023258880 7:38338442-38338464 AGAAAATCTCCATTTGTAGCTGG - Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1029999252 7:105041413-105041435 AGCAAAACTCCATCTGTTGCTGG - Intronic
1032598562 7:133268221-133268243 TGCAGAGCTCCGTTTGAATCTGG + Intronic
1037655410 8:20879331-20879353 TGTAGACGTCCATCTGTAGCTGG - Intergenic
1042729718 8:71919059-71919081 TGCATAACTCCATTTATATAAGG - Intronic
1044372614 8:91430326-91430348 TGTATAATTCCACTTGTAGCAGG - Intergenic
1044759002 8:95497045-95497067 TGAAGAACTCACTTTGTATCTGG + Intergenic
1044759392 8:95501877-95501899 TGAAGAACTCACTTTGTATCTGG - Intergenic
1050757727 9:9028346-9028368 TGCAGAACTAAAATTATAGCAGG + Intronic
1051633668 9:19162711-19162733 TGCAAAATTCCATATGTACCAGG + Intergenic
1052608422 9:30735828-30735850 TGCAGAAACACAATTGTAGCTGG - Intergenic
1056398043 9:86199407-86199429 TGCACAACTCCATGTATACCTGG + Intergenic
1059177681 9:112182087-112182109 TGCAGCACTCCATCTGAATCTGG - Intergenic
1060362354 9:122971631-122971653 TGCAGAATTCCAGTTTTAGTTGG - Intronic
1188917399 X:35929517-35929539 TGCTGAACTCCCTTTTTAGGAGG + Intronic
1189992900 X:46611555-46611577 GGCAGAACTACATTTTTACCAGG + Intronic
1190632847 X:52405400-52405422 TGGAAAACTCAATTTATAGCTGG - Intergenic
1194627548 X:96243241-96243263 TTCAGAACTCTATCTGTAGAAGG - Intergenic
1197458117 X:126702575-126702597 TGCAGATGTCCATTAGTATCTGG - Intergenic
1197820210 X:130534401-130534423 GGAAGAACTCCATTTGGTGCTGG - Intergenic