ID: 999198873

View in Genome Browser
Species Human (GRCh38)
Location 5:149802118-149802140
Sequence CCTTGGGCCAAGTCCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999198873_999198877 -6 Left 999198873 5:149802118-149802140 CCTTCTCAGGACTTGGCCCAAGG 0: 1
1: 0
2: 2
3: 17
4: 257
Right 999198877 5:149802135-149802157 CCAAGGCCCCAGCTTCTGTCTGG 0: 1
1: 0
2: 3
3: 37
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999198873 Original CRISPR CCTTGGGCCAAGTCCTGAGA AGG (reversed) Intronic
900105756 1:980381-980403 CCCTGCGGCCAGTCCTGAGACGG - Exonic
901734138 1:11301573-11301595 CCTTGGTCCTAATCTTGAGACGG + Intergenic
902285766 1:15407690-15407712 CCTTGGGCCTGGGCCAGAGATGG - Intergenic
902836342 1:19049282-19049304 CCCTGTGCCAAGCCCTGAGCTGG - Intergenic
902937827 1:19777243-19777265 CCTTGGGCCTTGTCCTGTGAGGG + Intronic
903230124 1:21916815-21916837 CCTTAGGCCAAGGCTGGAGATGG + Intronic
903298030 1:22358123-22358145 CCTTGGGCCAAGAACTATGAGGG - Intergenic
903889242 1:26558648-26558670 AGTTGGGCCAAGGCCTGTGATGG + Intronic
903925395 1:26827483-26827505 CCCTGGGGCAGGTTCTGAGAGGG - Intronic
904001104 1:27339272-27339294 CCTTTAGACACGTCCTGAGATGG - Intergenic
904749746 1:32734181-32734203 CTTTGGGCCCAGTGCTGGGATGG + Intergenic
906792680 1:48672558-48672580 CACTGGGCCAGGTCCTGGGAGGG - Intronic
907185128 1:52603171-52603193 CTCTAGGCCAAGTCCTTAGATGG + Intronic
907471198 1:54674555-54674577 CCATGTGCCAAGCCCAGAGATGG - Intronic
907702629 1:56804062-56804084 CCTTGGACCAGGTGCTGAGCTGG - Intronic
907728404 1:57042341-57042363 TCTTATGCCAAGGCCTGAGATGG - Intronic
912866958 1:113266401-113266423 CCTTGGGACAAGAACAGAGAAGG - Intergenic
914908770 1:151768199-151768221 CCTTGATCCAAGGCCTGATATGG - Exonic
915046683 1:153023311-153023333 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
915168432 1:153961803-153961825 CCTTGGGCCAAAGCCTAAAAAGG + Intronic
915252775 1:154602420-154602442 CCTTGGCCGGAGTCCTGGGAGGG + Exonic
915658238 1:157379843-157379865 TCTTGGGCCCAGCCCTGAGCTGG + Intergenic
917229841 1:172823846-172823868 CCATGGGCCAAGGCCTGGAATGG + Intergenic
918356361 1:183709224-183709246 CCTTGGGACTGGGCCTGAGAAGG + Intronic
919975060 1:202605010-202605032 CCTTGTGCCAAGTCTTGAGAGGG + Intronic
920577461 1:207072059-207072081 CCATGGGCCATGCCCTGTGAGGG + Intronic
920924775 1:210330670-210330692 CCCTGGGCCAGGTCCTAAGCTGG - Intronic
922088022 1:222369568-222369590 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
924863481 1:247952222-247952244 CCGTGAGGCCAGTCCTGAGAAGG + Intronic
1063010679 10:2019471-2019493 CCTTGGGCAAAATCCAGAGCTGG + Intergenic
1063225317 10:4010154-4010176 CCTTAGGCTAAGTGCTAAGAAGG + Intergenic
1064637797 10:17386920-17386942 CCTTGGGACTGGGCCTGAGAAGG + Intronic
1065857041 10:29839130-29839152 CCTGGTGCCAAGGCCTGAAATGG - Intergenic
1067937547 10:50624251-50624273 CCTTGGGGCAGGGCCGGAGACGG + Intronic
1068166031 10:53333630-53333652 CCCTGTCGCAAGTCCTGAGAGGG + Intergenic
1068607709 10:59024465-59024487 CATTGGGACAATTCCTGAGGTGG + Intergenic
1072860148 10:98994941-98994963 CTTTGGGCCAAGACCTTAGTGGG + Intronic
1072987292 10:100152087-100152109 CCTTGGGCCACATCTTGATATGG + Exonic
1073018340 10:100419973-100419995 CCTTGGGCCAGGTACTGCTAGGG + Intergenic
1073427859 10:103466928-103466950 ACTTGTGCAAAGGCCTGAGATGG - Intergenic
1074611488 10:115026285-115026307 GCTTGTTCCAAGACCTGAGATGG - Intergenic
1075449627 10:122540867-122540889 GCCTGGGCCAAGACCTGACATGG + Intergenic
1075795760 10:125118441-125118463 CCATGGGCCAAGTTTTGAAAGGG + Intronic
1078003672 11:7516834-7516856 CCTTGGGACTGGGCCTGAGAAGG + Intronic
1079003957 11:16779634-16779656 CCTTGGGCCAGGCTCTGAGGAGG - Intronic
1079566325 11:21887721-21887743 CCTTTTGGGAAGTCCTGAGAGGG + Intergenic
1081600057 11:44486734-44486756 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1083121886 11:60521040-60521062 GCTTGGGCCATGGCCTCAGAGGG - Intronic
1083792638 11:64995799-64995821 CCTTGGGCCATGTCCACAGCGGG + Intronic
1084470299 11:69355554-69355576 CCCTGGGCCAGGTCCTGGGTTGG + Intronic
1084791642 11:71478665-71478687 GCTTGGGCCAGGCCCTGAGCTGG + Intronic
1085300547 11:75455877-75455899 CTTTGGGCCCAGCCCTGAGGGGG + Intronic
1089738379 11:120564865-120564887 CCTTGTGCGAAGTCCTGAGCCGG - Intronic
1094107684 12:26832003-26832025 CAGTGGGCCAAGGCCTGGGAAGG + Intronic
1096803941 12:54128746-54128768 CCTTGTGCCTACTGCTGAGAGGG + Intergenic
1097180826 12:57170968-57170990 CCTTGAGCCCTGCCCTGAGAGGG + Intronic
1097498930 12:60378040-60378062 GCTTGGGCCATGGCTTGAGAGGG + Intergenic
1098283974 12:68889774-68889796 CCTTGGGACTGGGCCTGAGAAGG - Intronic
1098979179 12:76936619-76936641 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1100299058 12:93290539-93290561 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1102012261 12:109625975-109625997 CTCTGGGCTAAGACCTGAGATGG + Intergenic
1102876084 12:116449797-116449819 CCATGGGCCAATTCCTCATACGG + Intergenic
1102883969 12:116508061-116508083 CCCTGGGCCAGGTCCTGAGCTGG - Intergenic
1103952399 12:124558269-124558291 CCTTGGGCCAGGTCTGGAGGGGG - Intronic
1104179548 12:126365297-126365319 TCTTGGGCAAAGTCTGGAGAGGG - Intergenic
1104343732 12:127977094-127977116 CCATGGGCAATGACCTGAGAAGG - Intergenic
1105944329 13:25176726-25176748 CCTTGGGCTCAGTCATGAGTGGG + Intergenic
1106123219 13:26879349-26879371 CCTTGGGACAAGCCCTTAAATGG - Intergenic
1107453926 13:40537077-40537099 CCTGGGGCAAACTCCAGAGATGG + Intergenic
1110492370 13:76124539-76124561 GCTTGGGCCATGGCCTCAGAGGG + Intergenic
1112446410 13:99468573-99468595 CTTTGTGCCAAGTATTGAGATGG + Intergenic
1112868443 13:103937897-103937919 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1113086389 13:106573406-106573428 CCTAGGTCCTAGGCCTGAGATGG - Intergenic
1113508506 13:110832793-110832815 CCACGGGACAAGGCCTGAGATGG + Intergenic
1114236791 14:20831085-20831107 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1114237700 14:20836652-20836674 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1114773741 14:25457980-25458002 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1117508625 14:56426952-56426974 CCTTGGGCCTTGTCGTCAGATGG + Intergenic
1117969690 14:61239590-61239612 CCTTGGGACTGGGCCTGAGAAGG + Intronic
1118941599 14:70344702-70344724 CCTTGGGACTGGGCCTGAGAAGG - Intronic
1118942469 14:70350149-70350171 CCTTGGGACTGGGCCTGAGAAGG - Intronic
1119266238 14:73264647-73264669 GCTTGGCCAAAGTCCTGAGCTGG - Exonic
1120695775 14:87643218-87643240 ACTTGGCCCAAGGCCAGAGATGG + Intergenic
1121182540 14:91940371-91940393 CCTTGAGCTAAGCACTGAGAGGG - Intronic
1121314464 14:92952927-92952949 CCTTGGGGGAAGTCGTGGGATGG - Intronic
1122360669 14:101160253-101160275 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1124439725 15:29677239-29677261 CCTTGGGCTGAGTGCTGAGGAGG - Intergenic
1127119454 15:55758548-55758570 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1128536909 15:68498479-68498501 CCTTGGGCAAAATCCTAAGGTGG + Intergenic
1128801897 15:70502288-70502310 CCCTGGGCCAAGTCAGGAGGAGG + Intergenic
1128925374 15:71650555-71650577 CCTTGGGACTGGGCCTGAGAAGG - Intronic
1129182259 15:73884919-73884941 GGTTGGGCCAGGTCCTGGGAGGG - Intronic
1129611872 15:77066925-77066947 CCTTCTGCAAAGTCCTGAGGTGG + Intronic
1130744017 15:86631179-86631201 CCTTGGGACCAGGCCTGAGAAGG + Intronic
1131324584 15:91430059-91430081 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1132349762 15:101132538-101132560 CCTTGGGCCAGGATCTGACATGG - Intergenic
1133279158 16:4655414-4655436 CCTTGTGCCAGGTCCTGAGAGGG - Intronic
1134059038 16:11188032-11188054 CCTTGGGACTGGTCCTGGGAGGG + Intergenic
1138031112 16:53560133-53560155 CCTTGGGCCTGGGCCTGAGAAGG - Intergenic
1139073673 16:63416285-63416307 CTTTGTACCAAGCCCTGAGATGG - Intergenic
1140195427 16:72850953-72850975 CTTTGGGCCAAGTGGTGACAGGG + Intronic
1140947362 16:79781964-79781986 CCTTGGTCCCCCTCCTGAGAAGG - Intergenic
1142069593 16:88083826-88083848 CATTGGGCCGAATCCTGGGAGGG + Intronic
1142117793 16:88369144-88369166 CCTTGGGCGCCATCCTGAGATGG + Intergenic
1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG + Intronic
1142348533 16:89569469-89569491 CCCTGGGCCACCTCCAGAGAAGG - Intergenic
1142377270 16:89712388-89712410 CCTTGAGCCAAGGGCAGAGAAGG - Intronic
1142412192 16:89922590-89922612 CCTTGTGACAATTCCTGACACGG + Intronic
1143374112 17:6457423-6457445 CCTTGGGCCAGGGCCTGTGTTGG - Intronic
1143997042 17:11015610-11015632 CCTTGGACAAAGTCCTAAGATGG - Intergenic
1144032878 17:11337700-11337722 CCTAGAGCCAGGTCATGAGAAGG - Intronic
1146937259 17:36819787-36819809 ACTTGGTTCAAGTCCTGAGTGGG - Intergenic
1147672671 17:42185571-42185593 CCTTGGGCCCAGCCTGGAGACGG - Intergenic
1147878155 17:43636340-43636362 GCCTGCGCCAGGTCCTGAGATGG - Intergenic
1148855576 17:50577305-50577327 CCTGGGGCCAGGCCCTGAGCGGG + Intronic
1150979880 17:70129067-70129089 CCTTGGGACTGGGCCTGAGAAGG + Intronic
1152743714 17:82029790-82029812 CCTTGGATCAGGGCCTGAGACGG + Intronic
1155574055 18:27225833-27225855 CCTTGGTACCAGGCCTGAGAAGG - Intergenic
1155683769 18:28521336-28521358 CCCTGTGGCAAGTCCCGAGAAGG + Intergenic
1155804176 18:30145216-30145238 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1156523896 18:37747887-37747909 CCTTGGGGGAAGTCCTCACAAGG + Intergenic
1156755324 18:40516671-40516693 CTTTGGGCTAACTCCTCAGAGGG - Intergenic
1157150906 18:45216794-45216816 CCTTTGGCCAAGGCCCAAGAAGG + Intronic
1158351680 18:56570777-56570799 CATTAGGCCAAGTGATGAGAAGG - Intergenic
1158941156 18:62406698-62406720 CCTTTGGCCAAGAGCTGAGCAGG - Intergenic
1159915799 18:74186769-74186791 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1160551479 18:79696375-79696397 CCTTGAGCCAAGTCCTAACTGGG + Intronic
1160707314 19:535661-535683 CCTGGGGTCAAGTCCCCAGAAGG - Intronic
1162121856 19:8475260-8475282 CCCTGGGCCAAGTGCTGTGCTGG - Intronic
1162209128 19:9077659-9077681 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1162453754 19:10769983-10770005 CCTTGGGCCAAGTTCCGTGATGG - Intronic
1163296871 19:16418256-16418278 CCCTGGGCCACTTCCTGGGAAGG - Intronic
1163784633 19:19268594-19268616 CATTGGGACAAGGCCTAAGAGGG + Intronic
1163939745 19:20480649-20480671 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1165986747 19:39776329-39776351 CCATGGGCCAGGTCCTGTGCAGG + Intergenic
1166279916 19:41785152-41785174 CCTTGAGCCAAGACCAAAGAAGG + Intergenic
1166316194 19:41991555-41991577 CCTGGGGTCAAGTCCTGTGCAGG + Intronic
1166544634 19:43626758-43626780 CCCTGGGCCGAGTGCTGACAAGG - Intronic
925325921 2:3022007-3022029 CCTTGTGAGAAGTCCTGGGAGGG - Intergenic
926278692 2:11426277-11426299 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
926297742 2:11580874-11580896 CTTTGGGCCAAGGCCAGAGGGGG + Intronic
927376411 2:22420042-22420064 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
927760020 2:25744249-25744271 CCCTGGGCCAGGTCCTGGAATGG + Exonic
932187614 2:69712428-69712450 CCTTGGCCCAGGTCCTAATAGGG - Intronic
932788623 2:74632390-74632412 CCTTGGGCCAAGTCCTCCTCAGG + Intronic
933167480 2:79092348-79092370 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
933168551 2:79099562-79099584 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
933758855 2:85661151-85661173 CCCTGGGGCAAGCTCTGAGAGGG + Intronic
934836152 2:97590756-97590778 CCGTCGCCCAAGTCCTGTGATGG + Intergenic
934966018 2:98723259-98723281 CCTTGGGACTGGGCCTGAGAAGG - Intronic
935205404 2:100892541-100892563 CCTTGGGACAAGGCTGGAGAGGG + Intronic
935443005 2:103123599-103123621 CCATGGGCCATTTCCAGAGAGGG + Intergenic
935754490 2:106266308-106266330 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
936049046 2:109209273-109209295 CCTTGTGCCAGGTCCTGCGCGGG + Intronic
938314260 2:130315309-130315331 CCTTGGGCAGAGTCCAGAGATGG + Intergenic
939356849 2:141114077-141114099 CCCTGTGGCAAGTCCTGTGAGGG - Intronic
941151025 2:161915779-161915801 CCTTGTCACAAGTCCTGTGAAGG + Intronic
941285864 2:163611269-163611291 CCTGGGGCATATTCCTGAGATGG + Exonic
943417780 2:187630372-187630394 GCTTGGGCCATGGCCTCAGAGGG + Intergenic
943715887 2:191151512-191151534 GGTTGGGCCAAGTCCTGGGTAGG + Intronic
946845650 2:223856676-223856698 CCATGGGCCAAGTCCTGCTGAGG + Intronic
947596988 2:231419209-231419231 CCCTGTCCAAAGTCCTGAGAAGG + Intergenic
947767460 2:232646858-232646880 CCTTGGGCCAAGCCCTGGGCTGG - Intronic
948941334 2:241198283-241198305 CCATGTGCCAACACCTGAGAAGG - Intronic
1168764355 20:371784-371806 CTTTGGGGCCAGTGCTGAGAGGG - Intronic
1168856410 20:1012451-1012473 CCTAGGGGCAAGGCCAGAGAAGG + Intergenic
1170310060 20:14982596-14982618 GCTTGGGCCATGGCCTCAGAGGG + Intronic
1171130125 20:22644653-22644675 GCTTGGGCCAAGGCTTCAGAGGG - Intergenic
1171172230 20:23025814-23025836 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1173914224 20:46694710-46694732 CTTTGGGCCAAGTTCTTAGCTGG - Intergenic
1180869712 22:19139195-19139217 CCTTCAGCCAAGCCCTGAGCAGG - Exonic
1181595445 22:23911573-23911595 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1181725435 22:24807627-24807649 CCTTGGGCTAAGCGCTGATAAGG - Intronic
1183255282 22:36757894-36757916 CCTTGGGACAGGTTCTGAGCTGG + Intergenic
1183605446 22:38864903-38864925 CCTTAGGCCAGGCCCTGGGAGGG - Exonic
1184168515 22:42744624-42744646 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1185194480 22:49460405-49460427 CCTTCCTCCAAGGCCTGAGAAGG - Intronic
949754474 3:7393019-7393041 CCTTGGGCCGAGACCAGAGAGGG + Intronic
951446162 3:22782712-22782734 GCTTGGGCCATGGCCTCAGAGGG - Intergenic
952026803 3:29092617-29092639 CCTTGGGCCTAGAGCTGAAATGG + Intergenic
953040864 3:39253714-39253736 CCCTGGGCAGAGTCCTGGGAAGG + Intergenic
954558098 3:51534036-51534058 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
954611399 3:51946355-51946377 CTCTGGGCCAAGCCCTGGGAGGG + Intronic
955999990 3:64719514-64719536 CCTTGGGCAAAGGCTTGGGAAGG - Intergenic
960223973 3:115147947-115147969 CCTGGGGCCAATTGCCGAGAGGG + Intergenic
960811049 3:121627849-121627871 CCTTTGGCAAAGTCCAGACAAGG + Exonic
961734259 3:128991441-128991463 CCTTGGGACTAGGCTTGAGAAGG - Intronic
963975590 3:151476607-151476629 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
964440471 3:156703548-156703570 ACTTGGATGAAGTCCTGAGATGG - Exonic
965244433 3:166249136-166249158 GCTTGGGCCATGTCTTCAGAGGG + Intergenic
965249760 3:166327856-166327878 CCTTGGGCCATTGCCTCAGAGGG - Intergenic
965872899 3:173281565-173281587 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
968641030 4:1714902-1714924 CCTCTGGCCAAGACCAGAGATGG - Intergenic
970868179 4:20782555-20782577 GCTTGGGCCAAGGCTTCAGAGGG - Intronic
971812286 4:31441887-31441909 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
975140612 4:70914801-70914823 GCTTGGGCCCAGGCCAGAGAGGG - Intronic
978625038 4:110675632-110675654 CCTTGGGACATGGCCTGACAAGG + Intergenic
980821471 4:138022832-138022854 CCCTGTTGCAAGTCCTGAGAGGG - Intergenic
982000365 4:151015992-151016014 GCTTCTGCCAAGTCCTGAGGCGG + Intergenic
982449419 4:155534202-155534224 TCTTAGTCCAATTCCTGAGAAGG + Intergenic
983294546 4:165849855-165849877 CCTAGGGCCCACTACTGAGAAGG + Intergenic
984387290 4:179077329-179077351 CCTTGGGACTGGTCCTGAGGAGG + Intergenic
985722669 5:1497899-1497921 CCACGGGCCAAGTCCTGAGCTGG - Intronic
986627675 5:9737854-9737876 CCTTGGACAAAGATCTGAGAAGG - Intergenic
989586217 5:43075601-43075623 CCTTGGGACTGGGCCTGAGAAGG + Intronic
990042235 5:51389168-51389190 TCTTGGGCCAAGGCCACAGAGGG - Intronic
992592526 5:78310039-78310061 CCTTATGCCTAGTCCTGAGCAGG - Intergenic
992749118 5:79846075-79846097 CTTTGGGCCAAATCATGAAATGG - Intergenic
995513486 5:112930870-112930892 CCCTGTGCCATGTCCTGGGATGG - Intergenic
997228991 5:132229073-132229095 CATGGGGCAAACTCCTGAGAAGG - Intronic
999198873 5:149802118-149802140 CCTTGGGCCAAGTCCTGAGAAGG - Intronic
1000304657 5:159984338-159984360 CATTGGTCCATTTCCTGAGATGG - Intergenic
1001460768 5:171911610-171911632 CCTTGGGTCACTTTCTGAGAAGG - Intronic
1002465050 5:179404078-179404100 TCTTGTTCCCAGTCCTGAGATGG + Intergenic
1005142099 6:22644005-22644027 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1007176684 6:39902142-39902164 CCTTGGGCTGGGTCCTGGGATGG + Exonic
1007706615 6:43795194-43795216 CCTGGGGCCACATCCTGGGAAGG - Intergenic
1008928673 6:56914351-56914373 CCTTGGGCCAGTTGCTGAGAGGG + Intronic
1010444599 6:75936013-75936035 GCTTCCACCAAGTCCTGAGAAGG + Intronic
1011773484 6:90701551-90701573 CCTTGGGACAAAGGCTGAGAAGG + Intergenic
1015153528 6:130064715-130064737 CCTTGGGGAAAGGCTTGAGAAGG + Intronic
1015194421 6:130509970-130509992 CCTTGTTGCAAGTCCTGTGAAGG - Intergenic
1017522732 6:155216202-155216224 CCCTGTGCCATGTCCTCAGAAGG + Intronic
1018669555 6:166167694-166167716 CCTTGGACCGAGACCTGCGACGG + Exonic
1019093353 6:169558624-169558646 CCTGCAGCTAAGTCCTGAGATGG + Intronic
1019409622 7:900847-900869 CCCCCGGCGAAGTCCTGAGAAGG + Intronic
1019968613 7:4522263-4522285 CCTTGGGCCAAGTAGTGATTTGG + Intergenic
1022003969 7:26250271-26250293 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1022480700 7:30741351-30741373 CCTGGGGCCACGTCCCTAGAAGG - Intronic
1024629741 7:51237103-51237125 CCTTGGGCCAGGCCCAGAGCTGG - Intronic
1024630125 7:51240169-51240191 CCTTGGTCCAAGACCTAGGATGG + Intronic
1026108449 7:67439210-67439232 CCTGGGCCCAAGTGCTGAGCTGG - Intergenic
1026509677 7:71017670-71017692 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1029804117 7:102978372-102978394 CCTTGGGACTGGGCCTGAGAAGG - Intronic
1029883028 7:103836809-103836831 CCTTGGGCTAAGTGCTGTGTTGG - Intronic
1031473150 7:122191338-122191360 GCTTGGGCCATGTCTTCAGAGGG + Intergenic
1032168366 7:129563599-129563621 TCTTGGGCCAAGTCCTTCGCAGG + Intergenic
1032471691 7:132183661-132183683 CCTGGGGCCAAATCCTGGCATGG + Intronic
1033620644 7:143059220-143059242 CATTGAACCAAGTCCAGAGATGG - Intergenic
1034356184 7:150452048-150452070 CCTTGGGCTGTTTCCTGAGAAGG + Intronic
1037583562 8:20261351-20261373 CCTGGGGCCAGATTCTGAGAAGG - Intronic
1037879873 8:22567310-22567332 CATTGGGCCAAGCCCTGTGGGGG - Intronic
1039978181 8:42384587-42384609 CTTTGGCCAAAGTCCTGGGAAGG - Intergenic
1041173027 8:55164579-55164601 CCATGGGCCTAGCCCTGAGATGG + Intronic
1041564410 8:59260855-59260877 CCTTGGGCCATTTCCTGGGAAGG - Intergenic
1041914361 8:63125176-63125198 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1041916439 8:63144204-63144226 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1041916881 8:63147174-63147196 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1043471665 8:80569201-80569223 TCTTGGCTTAAGTCCTGAGAAGG + Intergenic
1044322933 8:90825596-90825618 CCTTAGGCAAAGTGTTGAGATGG + Intronic
1047209543 8:122830367-122830389 CCTTGGGACTGGGCCTGAGAAGG + Intronic
1048208687 8:132436813-132436835 CCCTGGGCTCAGTCCTCAGAAGG + Intronic
1049968712 9:802322-802344 CCTTGGCCCAAGACCTTTGAAGG + Intergenic
1052991487 9:34521518-34521540 CCCTGGCCCCTGTCCTGAGAAGG - Exonic
1056002447 9:82231224-82231246 CCTTGGGAGAAGTGCTCAGATGG - Intergenic
1057819606 9:98321125-98321147 CCCAGGGCCGAGTCCTGGGAAGG - Intronic
1061020258 9:128009741-128009763 GCTTGTGCAAAGCCCTGAGATGG - Intergenic
1061789995 9:133054296-133054318 CATGGGGCCAGCTCCTGAGAGGG - Intronic
1061949104 9:133926314-133926336 CCCAGAGCCAAGTCCTAAGAGGG + Intronic
1062151519 9:135021613-135021635 CCTTGAGCCAAGGCCAGAGGAGG - Intergenic
1187619762 X:21038907-21038929 GCTTGGGCTAACTCCTGAAATGG - Intergenic
1188255400 X:27956333-27956355 CCTAGGACCAAGTCCTGTGTTGG + Intergenic
1190065681 X:47240364-47240386 CTTTGGGCCAAGAACTCAGAAGG + Exonic
1191151498 X:57224494-57224516 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1193912015 X:87317319-87317341 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1195554873 X:106210527-106210549 ACTTGGGCCATGGCTTGAGAAGG - Intergenic
1195702450 X:107715654-107715676 CCTGCGGCAAAGACCTGAGATGG + Intronic
1195868292 X:109457521-109457543 CCTTGGGCATAGTCAAGAGATGG + Intronic
1195909709 X:109876698-109876720 CCTTGGGCCAACTGCTCAAAAGG + Intergenic
1197142567 X:123132566-123132588 CCTTGGGACTGGGCCTGAGAAGG - Intergenic
1197718073 X:129724552-129724574 CCTGGGCCCAAGGCCTGAGCTGG - Intergenic
1197947083 X:131851216-131851238 CCTTGGGACTGGGCCTGAGAAGG + Intergenic
1197962390 X:132021651-132021673 TCTTGGGCCCAGTCCAGACATGG + Intergenic
1199474369 X:148229419-148229441 CCTTGTGCAAAGTCCTGAGCTGG + Intergenic
1199726263 X:150585388-150585410 CCTTTAGCCCAGACCTGAGAAGG + Intronic
1200162748 X:154017836-154017858 CCGTGGGCCAAATCCTGAGCCGG + Intronic
1200178625 X:154136729-154136751 GCCTGGGCCATGTCCTGAAAGGG - Intergenic