ID: 999198967

View in Genome Browser
Species Human (GRCh38)
Location 5:149802640-149802662
Sequence TGCCTCACAGAAGTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 362}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999198967_999198974 17 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198974 5:149802680-149802702 ACAGATGGGGCAGCTGGGGCTGG 0: 1
1: 0
2: 13
3: 118
4: 886
999198967_999198977 28 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198977 5:149802691-149802713 AGCTGGGGCTGGGAGGACTCAGG No data
999198967_999198970 4 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198970 5:149802667-149802689 CAGCTTTATCTCTACAGATGGGG 0: 1
1: 0
2: 0
3: 8
4: 170
999198967_999198968 2 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198968 5:149802665-149802687 CACAGCTTTATCTCTACAGATGG 0: 1
1: 0
2: 0
3: 14
4: 160
999198967_999198972 12 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198972 5:149802675-149802697 TCTCTACAGATGGGGCAGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 204
999198967_999198976 21 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198976 5:149802684-149802706 ATGGGGCAGCTGGGGCTGGGAGG 0: 1
1: 1
2: 13
3: 116
4: 998
999198967_999198975 18 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198975 5:149802681-149802703 CAGATGGGGCAGCTGGGGCTGGG 0: 1
1: 1
2: 28
3: 195
4: 1281
999198967_999198971 11 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198971 5:149802674-149802696 ATCTCTACAGATGGGGCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 140
999198967_999198973 13 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198973 5:149802676-149802698 CTCTACAGATGGGGCAGCTGGGG 0: 1
1: 2
2: 31
3: 296
4: 1864
999198967_999198969 3 Left 999198967 5:149802640-149802662 CCTCATGACACTTCTGTGAGGCA 0: 1
1: 0
2: 2
3: 58
4: 362
Right 999198969 5:149802666-149802688 ACAGCTTTATCTCTACAGATGGG 0: 1
1: 0
2: 1
3: 4
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999198967 Original CRISPR TGCCTCACAGAAGTGTCATG AGG (reversed) Intronic
900935737 1:5765309-5765331 TGCTTCCCAGGAGTGTCGTGTGG + Intergenic
902723098 1:18317290-18317312 TGCCTCACAGGATTGTGGTGAGG - Intronic
902758161 1:18563024-18563046 TGCCTCACAGGGTTCTCATGTGG + Intergenic
903669893 1:25029111-25029133 TGAATCACTGAACTGTCATGAGG + Intergenic
903780540 1:25817575-25817597 TGCCTCACAGGCTTGTCGTGAGG - Exonic
903811628 1:26037934-26037956 TGCCTCACTGAGGAGTCAGGTGG - Intronic
904622611 1:31784255-31784277 TGCCTCTCAGAGTTGTTATGAGG + Intergenic
904689710 1:32284713-32284735 TACCTCATAGAATTGTTATGAGG - Intronic
904978207 1:34474653-34474675 TGCCTCACAAAATGGGCATGGGG + Intergenic
905387752 1:37615984-37616006 TGTGTCTCAGAAGTGTGATGGGG + Intronic
905583478 1:39099697-39099719 TGCCTCATTGAACTGTTATGGGG - Intronic
905657384 1:39693442-39693464 TGCCTCACAGAGCTCTTATGGGG - Intronic
905842156 1:41190728-41190750 AGCCTTACAGAAGTGTGATATGG + Intronic
906674219 1:47681567-47681589 TGCCTCACAGAATTGCTGTGAGG + Intergenic
906686681 1:47767505-47767527 TGCCTCCCAGTGTTGTCATGAGG - Intronic
907441495 1:54481352-54481374 TAACCCACATAAGTGTCATGTGG + Intergenic
907932399 1:59013004-59013026 TATCTCACAGAATTGTTATGCGG + Intergenic
908122442 1:60998932-60998954 TGCCTCATAGGATTGTCATGAGG - Intronic
908124732 1:61019259-61019281 AACCTCACAGAGATGTCATGAGG - Intronic
908154659 1:61340525-61340547 TACCTCTCAGGAGTGTAATGAGG + Intronic
908532325 1:65045619-65045641 CTCCTCATAGAACTGTCATGAGG + Intergenic
908597872 1:65708010-65708032 TGCCTCCCAGGAGTGTGGTGAGG + Intergenic
908643082 1:66246755-66246777 TCCCACAGAGGAGTGTCATGAGG - Intronic
909694918 1:78456280-78456302 TGCCTCATAGTTCTGTCATGAGG + Intronic
911053754 1:93693967-93693989 TGCCTCAAAGAGCTGTCGTGAGG - Intronic
912577102 1:110682604-110682626 TACCTCACAGAAGGAACATGAGG - Intergenic
912707668 1:111927057-111927079 TACCTCACAGAAGTATTGTGAGG - Intronic
913099156 1:115547059-115547081 TGACTCATAGAAGTATAATGAGG - Intergenic
913959886 1:143330874-143330896 TACCTCTCATAAGTGTCCTGTGG + Intergenic
914054245 1:144156447-144156469 TACCTCTCATAAGTGTCCTGTGG + Intergenic
914124901 1:144809914-144809936 TACCTCTCATAAGTGTCCTGTGG - Intergenic
914503998 1:148272827-148272849 AGCCTCACAGAAATCTCAAGGGG - Intergenic
915009237 1:152669656-152669678 TACATCACAGAATTGGCATGAGG + Intergenic
915353751 1:155243029-155243051 TACCTCACAGAATTGTTGTGAGG + Intronic
917166917 1:172122914-172122936 TCCCTCACAGAATTATTATGTGG + Intronic
917595722 1:176527315-176527337 TACCTCACAGAGTTGTCATTGGG - Intronic
918579135 1:186104589-186104611 TGCCTCACAGAGTTGCCATGAGG - Intronic
919659298 1:200228276-200228298 TGCCTCAGAAAAGTGTCACGTGG - Intergenic
920290646 1:204920847-204920869 TGCCTCTCAGAAGATTCCTGGGG - Intronic
922553648 1:226516776-226516798 AGCCTCCCAGCAGTGTCGTGAGG + Intergenic
922927586 1:229363185-229363207 TACATCACAGAGGTGTTATGAGG + Intergenic
923306442 1:232693244-232693266 TGCCTCACAGAGGTGCCCTAAGG + Intergenic
923496791 1:234532733-234532755 TTCCTCACAGCACAGTCATGAGG - Intergenic
1062775471 10:142455-142477 GTCCTCACAGAGGCGTCATGAGG + Intronic
1063276598 10:4575243-4575265 TGAATCAAAGAAGTCTCATGGGG + Intergenic
1065205187 10:23350404-23350426 TGTCTCACCAAACTGTCATGAGG + Intergenic
1065417589 10:25505053-25505075 TGCCTCATAGAATTGTTATGAGG + Intronic
1065934204 10:30506163-30506185 TGCCTCAAGGACTTGTCATGAGG + Intergenic
1067028299 10:42862952-42862974 TACCTCTCATAAGTGTCCTGTGG + Intergenic
1067759020 10:49029455-49029477 TGCCTCACAGTGCTGGCATGAGG - Intronic
1069896711 10:71684600-71684622 AGCCTCACAAAAATATCATGAGG - Intronic
1070510705 10:77158177-77158199 TGCCTCAAAGAAGATTCTTGAGG - Intronic
1070685800 10:78479890-78479912 TACATCAGAGAACTGTCATGAGG - Intergenic
1070795377 10:79213264-79213286 TGCCTCACAGAACTTTCTGGGGG + Intronic
1070917589 10:80164800-80164822 TACCTCACAGGAAAGTCATGAGG + Intronic
1072494262 10:95940054-95940076 GGCCTCCCAGAAGTTTCTTGAGG - Intergenic
1072635647 10:97176228-97176250 TTCCTCCCAGGAGTGTTATGAGG + Intronic
1072852141 10:98907040-98907062 TTCCTCACAGAATTGTTGTGAGG - Intronic
1072993318 10:100219581-100219603 TGCTTCACAGAATTGTTATTAGG + Intronic
1073081567 10:100864003-100864025 TGCCTCACAGAGGTTTCTTCTGG - Intergenic
1074188717 10:111117544-111117566 TACCTCACAGGGATGTCATGAGG - Intergenic
1074250048 10:111736015-111736037 TATCTCACAGGATTGTCATGTGG + Intergenic
1074803470 10:117025740-117025762 TGGCTCCCATAAGAGTCATGAGG + Intronic
1075391031 10:122091967-122091989 TGCCTCAAAGAATTGCCATGAGG + Intronic
1075596997 10:123739392-123739414 TGCCTCTTAGAATTGTCACGGGG - Intronic
1075705028 10:124495368-124495390 TGCCTAACAGGAGTGGCAGGGGG + Intronic
1077184574 11:1230417-1230439 TGCCCCCCAGAAGTGTGCTGGGG - Intronic
1077489636 11:2854912-2854934 TGCCTGGCAGAAGTGTCCCGTGG - Intergenic
1079003972 11:16779695-16779717 TGCCTCACAGCAGAGTCAGCAGG - Intronic
1080106658 11:28518240-28518262 TGCCACCCAGATGTGTCATGTGG - Intergenic
1080824654 11:35837665-35837687 TGCCTCACAGGTGTGTAAGGAGG + Intergenic
1082117756 11:48345955-48345977 TGCCTCAAAGAAATGTTCTGTGG + Intergenic
1083295516 11:61713365-61713387 TACCTCACAGAACTGTTATGAGG + Intronic
1084177776 11:67432469-67432491 TGCCTCACAGAGCTGCCGTGGGG - Intronic
1084323459 11:68386118-68386140 AGCCTCCCAGAGGTGTCATGAGG + Intronic
1085100998 11:73799802-73799824 TGCCTCACAGAATGGTTGTGAGG + Intronic
1085225867 11:74920735-74920757 TACCTCACAGAGCTGTTATGAGG + Intronic
1085268075 11:75249416-75249438 TGCTTCACAGAATTGTCATCAGG - Intergenic
1085645642 11:78220596-78220618 TACCTTACAGGATTGTCATGAGG - Intronic
1085793168 11:79513614-79513636 TGCCTCCCAGGATTGTTATGAGG - Intergenic
1085799857 11:79579462-79579484 TGCCTCACAGCAGCTCCATGAGG + Intergenic
1085877593 11:80427426-80427448 TACCTCACAGGATTGTCATGAGG - Intergenic
1088467670 11:110158651-110158673 TGTCTCACAGAAAGGTCATGGGG + Intronic
1088551169 11:111013837-111013859 TGCCTCACAGAGTTGTTGTGGGG - Intergenic
1088936283 11:114403677-114403699 TTCCTCACAGCAGTTTTATGAGG + Intronic
1089568468 11:119385997-119386019 TGCCTAACAGAAGAGTCCTGAGG - Intergenic
1089860034 11:121581740-121581762 TGCCTCCCAGAATTGTCATTTGG + Intronic
1089907208 11:122053048-122053070 TATCTCAAAGAACTGTCATGAGG + Intergenic
1090879691 11:130822803-130822825 TGCCTCACAGGATTGGCACGGGG + Intergenic
1091971290 12:4789218-4789240 TGCCTCATAGGGGTCTCATGCGG + Intronic
1092118153 12:6024236-6024258 TGCCTCACTGCAGTGCTATGGGG + Intronic
1092847027 12:12593090-12593112 TGACTCACAGATGTTTCAAGGGG + Intergenic
1093665027 12:21802205-21802227 TGCCTCAGAGAAGGGTGATGAGG + Intronic
1095333260 12:40994696-40994718 TACCTCACAGAAATTTCATCAGG - Intronic
1095968372 12:47884320-47884342 TGCCTCACAGAACTGTTGTGAGG - Intronic
1096112148 12:49035240-49035262 TACCTCACAGAGGTGTTAAGAGG + Intronic
1096354223 12:50926709-50926731 TGCCTCACACAATGGGCATGTGG - Intronic
1096635631 12:52957233-52957255 TACCTCACAGGATTGTAATGAGG - Intergenic
1097351263 12:58551654-58551676 TACCTCTCAGATTTGTCATGAGG - Intronic
1098391311 12:69972363-69972385 TACCTCACAGGCTTGTCATGAGG - Intergenic
1100183518 12:92111366-92111388 TGCCTCACAGAGGTATTGTGAGG + Intronic
1100252968 12:92849394-92849416 TGAATCAAAGAAGTCTCATGAGG - Intronic
1100945749 12:99782212-99782234 TCCCTAACAGAAAGGTCATGTGG + Intronic
1101034361 12:100690370-100690392 TACCTCAAAGGATTGTCATGTGG - Intergenic
1101841164 12:108328412-108328434 TTCCTCACTGAAGTGTTGTGGGG - Intronic
1102242044 12:111330507-111330529 TACCTCTTAGAGGTGTCATGAGG + Intronic
1102721010 12:115016062-115016084 TCCAACAGAGAAGTGTCATGTGG - Intergenic
1103423719 12:120812570-120812592 TGCCTCACAGCAGTGAAAAGAGG + Intronic
1104082882 12:125446211-125446233 GGCCTCACAGAACTGTTGTGAGG + Intronic
1106482853 13:30149786-30149808 TGCCTCACAGATTGGCCATGAGG + Intergenic
1106780146 13:33051170-33051192 TGCCTCACAGGACTGTTGTGAGG - Intronic
1107018142 13:35725236-35725258 TGCCTCTCAGGATTGTCATCAGG - Intergenic
1107631301 13:42345242-42345264 TGCTTCACAGAAGTGCAATTTGG + Intergenic
1107695068 13:42992074-42992096 TGCCGCCCAGAAGGGTCCTGGGG + Exonic
1107759124 13:43657500-43657522 TGCCTCTCAGCAGAGCCATGAGG - Intronic
1108593167 13:51928413-51928435 TGTCTCACAGCACTGCCATGAGG - Intergenic
1110184305 13:72655588-72655610 TATCTCACAGAATTGTTATGAGG - Intergenic
1110338061 13:74355204-74355226 TACCTCTCAGAATTGTCTTGAGG + Intergenic
1111059620 13:82999005-82999027 TGCCACCCAGAAGAGTGATGTGG - Intergenic
1111900639 13:94195609-94195631 TGCCCCATAGGACTGTCATGAGG + Intronic
1112115875 13:96352846-96352868 TACTTCACAGAGGTGTCAGGAGG - Intronic
1112255572 13:97827406-97827428 AGTCCCACAGCAGTGTCATGAGG - Intergenic
1118324542 14:64772227-64772249 TGCCTCAGAGGACTGCCATGAGG + Intronic
1118801092 14:69190642-69190664 TGCCTCACAGGGTTGTTATGGGG + Intergenic
1120752762 14:88213251-88213273 TGGCTCACAGAAGTAACATGAGG + Intronic
1120756801 14:88252213-88252235 TCTCTCTCAGAAGTGTCCTGGGG - Intronic
1121630494 14:95418387-95418409 TACATGACAGAATTGTCATGAGG + Intronic
1122199130 14:100111489-100111511 CACCTCACAGAGTTGTCATGAGG + Intronic
1125874604 15:43133293-43133315 TGTCTCACAAATGTGTCAGGTGG - Intronic
1127697088 15:61460799-61460821 TGCCACATAGATTTGTCATGAGG + Intergenic
1127858722 15:62974854-62974876 TGCCTCACAGAATTGTTGAGTGG + Intergenic
1127864434 15:63020326-63020348 AGCCTCACAGTATTGACATGTGG - Intergenic
1127902668 15:63352521-63352543 GACCTCCAAGAAGTGTCATGGGG - Intronic
1129856233 15:78827240-78827262 TGTCTCACAGAGCAGTCATGGGG + Intronic
1131210069 15:90487379-90487401 TACCTCACAGAAGTCCCAAGCGG - Intronic
1131559283 15:93425151-93425173 TACCTCACAGAGTTGTCATGAGG + Intergenic
1132915966 16:2344062-2344084 TTCCTCACAGAATTGTTGTGAGG + Intergenic
1133919785 16:10141750-10141772 TACCTCACAGAGGTGCCCTGAGG - Intronic
1135624024 16:23980115-23980137 TTCCTCACAGGACTGTGATGAGG + Intronic
1137785892 16:51137462-51137484 TGCCTCCTAGAAATGTCATGGGG + Exonic
1138100137 16:54245661-54245683 TCCCTCACAGAGTTGTCCTGAGG - Exonic
1140177099 16:72673155-72673177 TGCATCATGGAAGTGTCAGGAGG + Intergenic
1141611541 16:85183896-85183918 TTCTTCACAGAGATGTCATGAGG + Intronic
1141725558 16:85786137-85786159 TGCCTCAGAGAGTAGTCATGAGG - Intronic
1143315354 17:6027854-6027876 TGCCTCTCAGGAGAGCCATGCGG + Intronic
1144000892 17:11053983-11054005 TGCTTTATGGAAGTGTCATGTGG + Intergenic
1144215835 17:13054407-13054429 TGCCTCATAGAATTGTTGTGAGG - Intergenic
1144340512 17:14305856-14305878 TACTTCACAGAACTGTAATGAGG - Intronic
1144589695 17:16513729-16513751 TGCCTCGCAGAAGTTCCTTGAGG + Intergenic
1144611342 17:16719650-16719672 GACCTCACAGAATTGTTATGAGG + Intronic
1144901395 17:18595708-18595730 GACCTCACAGAATTGTTATGAGG - Intergenic
1145131105 17:20350388-20350410 GACCTCACAGAATTGTTATGAGG + Intergenic
1145270655 17:21402991-21403013 TGCATCACAGAAGTCCCAGGTGG - Intronic
1145308860 17:21690381-21690403 TGCATCACAGAAGTCCCAGGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146629752 17:34461266-34461288 TACCTCACAGAGTTGCCATGAGG - Intergenic
1148525417 17:48328183-48328205 ACCCTCACAGCAGTCTCATGAGG - Intronic
1149259536 17:54863956-54863978 TACCTTGCAGAAGTGTTATGAGG - Intergenic
1149400744 17:56293604-56293626 TGTCTCACAAAAGTGAGATGTGG + Intronic
1149454710 17:56778566-56778588 TACCTCTCAGAGGTATCATGAGG - Intergenic
1149557606 17:57585239-57585261 TGCCTTACAGACATGTCAAGTGG + Intronic
1149690959 17:58575967-58575989 TGCCTCACAGGGTTGTTATGTGG + Intronic
1150044093 17:61894254-61894276 TGCCTCAAAGCATTGTTATGGGG + Intronic
1150636188 17:66914964-66914986 GGCCTCACAGAAGCATCATGGGG - Intergenic
1152945773 17:83196677-83196699 TGCCTCCCAGAAGTGTCCCAAGG + Intergenic
1153496569 18:5705379-5705401 TGCCTCAGAGAAGAGTCTGGTGG - Intergenic
1154059082 18:11042064-11042086 TGCCTCTCAGCAGTGTTCTGGGG + Intronic
1154205623 18:12334401-12334423 TGCCTCACAGAGGGCTCATCTGG + Intronic
1155110383 18:22708756-22708778 CTCCTCACTGCAGTGTCATGAGG - Intergenic
1155633405 18:27922236-27922258 TACCTCACGGAAGTGTTATGAGG + Intergenic
1155807153 18:30185435-30185457 GGCCTCACAGCAGTGTCTAGGGG - Intergenic
1157155203 18:45258766-45258788 TCCCTCACTGAGCTGTCATGGGG - Intronic
1158566982 18:58562438-58562460 TGCCTTACTGAAGTGTCAGTTGG + Intronic
1159055539 18:63459627-63459649 TGCCTCACAGAAGTGGCAAGAGG - Intergenic
1160071673 18:75634639-75634661 TGCCTCACTCAAATCTCATGTGG + Intergenic
1161515001 19:4691564-4691586 TGCCACACACAGATGTCATGTGG - Intronic
1162639929 19:12000243-12000265 AGCCCCACAGCAGTGTCAAGGGG - Intergenic
1164534210 19:29072882-29072904 TGCACCACAGAAGTGGCATGAGG + Intergenic
1165744932 19:38224900-38224922 TGCCTCACTGGAGTGTTGTGAGG + Intronic
1166098496 19:40556387-40556409 TGTCTCACAGCAGAGCCATGAGG - Intronic
1168462288 19:56569048-56569070 TACCTCACAGTACTGTCATAAGG + Intronic
1202693724 1_KI270712v1_random:109125-109147 TACCTCTCATAAGTGTCCTGTGG + Intergenic
925381803 2:3433386-3433408 TGCCTCACAGAAGGGTCTGCGGG - Intronic
925664394 2:6237945-6237967 TCCATCACAGAACTGTCAGGTGG + Intergenic
925689671 2:6508140-6508162 TGCCCTACAGAAGTGTCCTTTGG - Intergenic
927075627 2:19574121-19574143 TCCCTCATGGAAATGTCATGAGG - Intergenic
927583545 2:24277976-24277998 TGCCTCACAGAGTTGTTGTGAGG + Intronic
927758152 2:25725273-25725295 TACCTCACAGGAGAGTAATGCGG + Intergenic
927866852 2:26594400-26594422 TGCCTCACCCAAGTGGGATGTGG - Intronic
928114347 2:28536308-28536330 TGGCTCACAGCAGTGACCTGAGG + Intronic
929878808 2:45819192-45819214 TCCCTCACAGAATTGTTGTGAGG - Intronic
930553498 2:52866431-52866453 AGCCCCCCAGAAGTGTCTTGTGG + Intergenic
931874660 2:66498698-66498720 TGCCTCACTGAAGTGGGACGTGG - Intronic
932173297 2:69577078-69577100 CGCCTCACAGGCTTGTCATGAGG - Intronic
933952840 2:87345450-87345472 TACCTCTCATAAGTGTCCTGTGG - Intergenic
933979419 2:87538302-87538324 TGCCTCATGGAATTGTCATGAGG + Intergenic
934237077 2:90241796-90241818 TACCTCTCATAAGTGTCCTGTGG - Intergenic
935847335 2:107180883-107180905 TTCCTCTCAGGAGTGTCATGAGG - Intergenic
936314406 2:111412489-111412511 TGCCTCATGGAATTGTCATGAGG - Intergenic
936562727 2:113555833-113555855 TGCCTCACAGATGTGTCTGCAGG + Intergenic
937052331 2:118902550-118902572 AGCCTCTCAGAAGTGCCATAGGG + Intergenic
937346551 2:121129709-121129731 TAGCTCACAGAAGTGCCAAGGGG - Intergenic
939126340 2:138181986-138182008 TGCCCCACAAAATTGTTATGAGG - Intergenic
940282010 2:151998541-151998563 TGCCTCACAAGATTGTTATGAGG + Intronic
940406109 2:153304519-153304541 TCCCTCACAGCAGCCTCATGGGG + Intergenic
943869196 2:192972200-192972222 CTGCTTACAGAAGTGTCATGAGG + Intergenic
944476398 2:200111061-200111083 AACCTCACAGACTTGTCATGAGG - Intergenic
947104235 2:226651486-226651508 TGCCTCACAGAATTGCTATGAGG + Intergenic
947626958 2:231625691-231625713 TGCCTGACAGAGATGTCAGGAGG - Intergenic
947921119 2:233875259-233875281 GACCTCACAGAACTGTGATGGGG - Intergenic
947994507 2:234515693-234515715 TGCCAGGCAGAGGTGTCATGTGG + Intergenic
1168768689 20:399610-399632 TGCCTCACTGGATTGTCATGAGG - Intergenic
1168867124 20:1096369-1096391 TGCTTCCCAGAAGTGTAATAAGG - Intergenic
1169508961 20:6243432-6243454 TTCCTTAGAGAAGTGTCACGAGG - Intergenic
1170138846 20:13104940-13104962 TACTTCTCAGAGGTGTCATGGGG + Intronic
1171143475 20:22762807-22762829 TGGCTCACAGCTGTGTCCTGGGG + Intergenic
1172739337 20:37153321-37153343 TGGATCAAAGAAGTGACATGGGG + Intronic
1173139246 20:40467770-40467792 TACCTCACTGGATTGTCATGAGG - Intergenic
1174001869 20:47380591-47380613 TCCTTGACAGCAGTGTCATGGGG - Intergenic
1175306231 20:57977477-57977499 TGCCCCACAGAAGTGGGGTGGGG + Intergenic
1175379511 20:58553135-58553157 TGCCTCACAGGATTGTGATGGGG - Intergenic
1175421076 20:58834115-58834137 TCCCTCCCAGAAGTCTGATGGGG + Intergenic
1177302084 21:19260678-19260700 TGCCCCACAGAAGTGTTTTCAGG + Intergenic
1177419975 21:20843847-20843869 TGCCTCACTGTAGGGTAATGTGG - Intergenic
1178361095 21:31949020-31949042 TGTCTCACAGGACTGTCCTGAGG - Intronic
1178494610 21:33076202-33076224 TGCCTCACAGTGTTTTCATGTGG + Intergenic
1178533743 21:33395971-33395993 TACCTCATAGATGTGTTATGAGG + Intergenic
1179241676 21:39598411-39598433 TGCCACACAGATGTGTCGTAGGG + Intronic
1179351112 21:40611773-40611795 TGCTTCACTGAAGTCCCATGAGG - Intronic
1180569585 22:16702653-16702675 TGCCTCACTGCAGTGCTATGGGG + Intergenic
1180630865 22:17229034-17229056 TACCTCACAGAATTGTCCTGAGG - Intergenic
1181421705 22:22803710-22803732 TGCCTCAGGGGACTGTCATGGGG + Intronic
1181803196 22:25360350-25360372 AGCCTCCCAGACCTGTCATGAGG - Exonic
1181907934 22:26214303-26214325 TGCCTCACAGAGCTGTCCTGAGG + Intronic
1183257586 22:36772394-36772416 TACCCCACAGAATTGTTATGAGG + Intronic
1183377386 22:37473113-37473135 TTCCTCACAGTAGTCACATGAGG - Intronic
1184315231 22:43682712-43682734 TGCCTCACCAAGGTGTCAAGAGG + Intronic
1185276292 22:49951452-49951474 TGCGTCACAGCAGTGCCCTGTGG + Intergenic
949104230 3:183928-183950 TTCCTAACAGAGGTGTCCTGTGG - Intergenic
949509077 3:4752964-4752986 AGCTTCAGAGAAGTGTGATGGGG + Intronic
950796568 3:15515245-15515267 TGTCTCACAGAATTGCTATGAGG - Intronic
951678703 3:25272237-25272259 TCCCTCACATCAGTGTCATGTGG - Intronic
955444713 3:58997410-58997432 TTCCTCACTGAATTGTCATGAGG - Intronic
955902868 3:63775910-63775932 TACCTCACAGCATTGTCATAAGG - Intergenic
956339658 3:68208393-68208415 TGCATCCCAGAAGTTTCTTGGGG - Intronic
956528076 3:70186867-70186889 TGTCTGACAGACATGTCATGGGG - Intergenic
957570171 3:81937035-81937057 AGCCTGAGAGAAGTGTCATGTGG + Intergenic
960122302 3:113959073-113959095 TACCTCACAGAGCCGTCATGAGG + Intronic
960815497 3:121667924-121667946 AGCCTCACAGAAGTGATGTGAGG - Intronic
961191237 3:124963762-124963784 TGCCTCACAAAGTTCTCATGAGG - Intergenic
961250346 3:125498596-125498618 TGCCTCACAGGGTTGTCATAAGG - Intronic
961476518 3:127150185-127150207 TGCCCCACAGAATGTTCATGGGG - Intergenic
961597295 3:128028560-128028582 AGCTTCACAGAAGAGCCATGGGG + Intergenic
962375784 3:134857643-134857665 TGCCTCCCAGAATGGTCCTGGGG - Intronic
964230148 3:154456575-154456597 TGCCTCACAGAATAGACATGAGG - Intergenic
964565866 3:158051875-158051897 TTCCTCAGAGAAGCTTCATGAGG + Intergenic
966149518 3:176851280-176851302 TGCCTCCAAGAATTGTTATGGGG + Intergenic
966304806 3:178519469-178519491 TACCTCACAGAATTATCATTAGG - Intronic
966648754 3:182275189-182275211 AGCCTCATAGGATTGTCATGAGG + Intergenic
967830473 3:193914757-193914779 TGCCTTACAAGAATGTCATGAGG - Intergenic
967915322 3:194574078-194574100 TTCCTCACAGAACTGTTATCGGG - Intergenic
967949088 3:194826677-194826699 TGGCTCAGAGAAGTGACATCCGG - Intergenic
969219568 4:5751179-5751201 TGCCACACAGATTTGACATGAGG - Intronic
969374573 4:6754776-6754798 TGACTCAAAGCCGTGTCATGTGG - Intergenic
969858157 4:10016388-10016410 TACCTCACAGGGCTGTCATGAGG + Intronic
969860915 4:10034692-10034714 AGCCTCACAGGAGTGTTATGAGG + Intronic
971188316 4:24402462-24402484 TGCCTCATCGGATTGTCATGGGG - Intergenic
971523063 4:27579699-27579721 TGAATGACAGAAATGTCATGGGG - Intergenic
972328632 4:38042593-38042615 TTCCTCGCAGAGCTGTCATGAGG - Intronic
974087311 4:57275232-57275254 TGACTCACAGAACTGTCTTCTGG + Intergenic
974721032 4:65738011-65738033 TATCTCACTGGAGTGTCATGTGG - Intergenic
975279788 4:72548025-72548047 TTCCTCACAGAATTCTAATGTGG - Intronic
975497366 4:75049282-75049304 TACCTCACAGATGTGTTGTGAGG + Exonic
975647606 4:76560888-76560910 TGCCTCACAAAATTGTTGTGAGG + Intronic
975940492 4:79638670-79638692 TTCCTCACAGTTGTGTAATGAGG - Intergenic
976707425 4:88034100-88034122 TACCTCTCAGAACTGTCTTGGGG - Intronic
976814787 4:89135148-89135170 TGCCTCACAGGATTGGTATGTGG + Intergenic
978611343 4:110544241-110544263 TTCCTCACAGAAGTCTTATAAGG - Intronic
978650665 4:111000441-111000463 TATCTCACAGAATTGTGATGAGG - Intergenic
981463243 4:145035467-145035489 TGCTTCACACCATTGTCATGGGG + Intronic
981608217 4:146563293-146563315 TCCCTCACAGAGATGTGATGAGG - Intergenic
984551773 4:181169329-181169351 TGCTTCCCAGAACGGTCATGAGG - Intergenic
984734130 4:183095244-183095266 TCCATCAGAGAAGTATCATGAGG - Intergenic
986098502 5:4583990-4584012 TGCCTCACAGATGTTTCCTGAGG - Intergenic
986512776 5:8525608-8525630 TTGGTCACAGAAGTCTCATGGGG + Intergenic
987295336 5:16545469-16545491 TGCCTCATGGAATTGTCTTGAGG + Intronic
988961739 5:36377894-36377916 TACCTTACACAATTGTCATGAGG - Intergenic
989217055 5:38916481-38916503 TGCCCCATAGAATTGTTATGAGG + Intronic
989505031 5:42217251-42217273 CGCCTCACAGTAGTGTCTAGGGG + Intergenic
990502235 5:56407974-56407996 GGCATCACAGGAGTGTCAAGGGG + Intergenic
990624102 5:57592468-57592490 TGACTCACAGTAGAGTCATCTGG + Intergenic
991652757 5:68872903-68872925 TACCTCACAGAAGTGTAGTGAGG + Intergenic
991776900 5:70094191-70094213 TGGCCCACAGAAGATTCATGTGG + Intergenic
991856187 5:70969636-70969658 TGGCCCACAGAAGATTCATGTGG + Exonic
991870203 5:71102430-71102452 TGGCCCACAGAAGATTCATGTGG + Intergenic
992206943 5:74440140-74440162 TCCCTCACAGAAGGGAAATGAGG + Intergenic
993026251 5:82650373-82650395 TACCTCACAGGATTGTCATGAGG - Intergenic
995229320 5:109740611-109740633 GGACTCACACAAGTGCCATGAGG + Intronic
995398905 5:111718632-111718654 TGGCCCACAAAAGTGTGATGTGG - Intronic
997883227 5:137609188-137609210 TGCCTCTTAGGATTGTCATGGGG + Intergenic
998043245 5:138966728-138966750 TGCCTCATTGAGTTGTCATGAGG - Intronic
998177038 5:139907976-139907998 TCCCTCACAGGATTGTCGTGAGG - Intronic
998231934 5:140366400-140366422 GGCCTCACAGGGTTGTCATGAGG + Intronic
998585381 5:143421471-143421493 TACCTCACAGGATTGTTATGAGG + Intronic
999109996 5:149111083-149111105 TGCCTCACAGGAATGTTATGAGG - Intergenic
999198967 5:149802640-149802662 TGCCTCACAGAAGTGTCATGAGG - Intronic
1000215014 5:159146968-159146990 GCCCTCACAGAACTCTCATGGGG - Intergenic
1000254884 5:159528017-159528039 TGCCTCACAGAGTTGCCGTGCGG - Intergenic
1000372712 5:160552530-160552552 TGCCTCACAGGGCTGTCATGAGG + Intergenic
1001280143 5:170380888-170380910 TGCCTAGGAGAACTGTCATGGGG + Intronic
1001406102 5:171478848-171478870 TACCTCATAGAATTGTCACGAGG + Intergenic
1002027275 5:176404189-176404211 TGCGTCACAGAAGTGACTTTGGG - Intronic
1002164084 5:177333867-177333889 TGGCTCACAGAAGGGACAGGTGG + Intronic
1002853561 6:1018087-1018109 TGCCACACACAAGTATCCTGAGG - Intergenic
1003164305 6:3663084-3663106 TGCCACCCAGCAGTGTCATCTGG + Intergenic
1004941783 6:20566294-20566316 GGCCACACAGAAGGGTCATGAGG - Intronic
1006438802 6:34040792-34040814 GTCCTCACAGTGGTGTCATGGGG + Intronic
1007052986 6:38851968-38851990 CACCTCACAGGACTGTCATGAGG + Intronic
1007490903 6:42221084-42221106 GGCCTCACGGAAGTGCCATTTGG - Intergenic
1007658592 6:43468250-43468272 TACCTCACAGAGTTGTCTTGAGG - Intergenic
1010768857 6:79805846-79805868 TGCCTGTCAGAACTGTCATGGGG + Intergenic
1012461474 6:99466434-99466456 TGCCTCATAGGTGTGTCATGAGG + Intronic
1013140445 6:107328591-107328613 TGCCTCACAGAGTTCTCATTAGG + Intronic
1013149645 6:107431817-107431839 TGTCTCACAGGATTGTAATGAGG - Intronic
1013684845 6:112567489-112567511 TGCTCAACAGAAGTTTCATGGGG - Intergenic
1014026041 6:116646913-116646935 GGCCTCACTCAAGTGACATGTGG + Intronic
1014790032 6:125662058-125662080 TGCCTCACACAGTTATCATGAGG + Intergenic
1015539823 6:134302717-134302739 TACCTCAAAGAACTGTTATGAGG - Intronic
1015756317 6:136610053-136610075 TACCTCACAGAATTGAGATGGGG + Intronic
1017759948 6:157560826-157560848 TGACTCACAGAAGCATTATGAGG + Intronic
1017883316 6:158577158-158577180 TGCCTAACAGATCTGTCATATGG - Intronic
1018029156 6:159828289-159828311 TGCCCCACCTAAGTGTCACGTGG - Intergenic
1018164177 6:161078213-161078235 TGACTCCCAGAAATGTTATGTGG + Intronic
1020634596 7:10681360-10681382 TACCTTATAGGAGTGTCATGAGG - Intergenic
1020976855 7:15017205-15017227 TGCATCACAGATGTGGCAAGGGG - Intergenic
1021684842 7:23174653-23174675 TGCATCACAGAAGTGCTATACGG + Exonic
1022335862 7:29421360-29421382 TGCCTCTCAGAAGTGTCCTCAGG + Intronic
1023659482 7:42457776-42457798 TGCTTCCCAAAAGTGTCCTGAGG - Intergenic
1023840034 7:44091805-44091827 TGCCCCACAGGAATGTCATGAGG - Intergenic
1024097025 7:45990322-45990344 TGCCTCCCAGGAGTGCCCTGGGG - Intergenic
1024589573 7:50869521-50869543 TGGCTCACAGTCGAGTCATGTGG + Intergenic
1025888347 7:65621063-65621085 TGCCTGGCAGAAGTGTGAGGAGG + Intergenic
1026587265 7:71666071-71666093 AGCCCCACAGGAGTGTCATGCGG + Intronic
1027219275 7:76203671-76203693 ATCCTCACAGAAGCTTCATGAGG + Intronic
1028319723 7:89444136-89444158 TACCTCACAGAATTGTTCTGAGG + Intergenic
1028709780 7:93893769-93893791 TACCTCGCAGATGTGTTATGAGG + Intronic
1029946154 7:104535285-104535307 TGCCTGACAGAAGTATCATTTGG - Intronic
1030091694 7:105863752-105863774 TGCCTCACAGGGTGGTCATGAGG + Intronic
1031634462 7:124085006-124085028 TGCCTCACAGAATTGTCCTGAGG + Intergenic
1031854089 7:126900904-126900926 TGCCTGGCAGAAGTGTGAAGAGG - Intronic
1031920760 7:127599115-127599137 AGCCTCACAGAGTTGTCATGAGG + Intronic
1033609366 7:142951253-142951275 AGCCTCCAAGAAGTGCCATGAGG + Intronic
1034501147 7:151451827-151451849 TGCCTCACAGCAGGGACTTGTGG - Intergenic
1034930955 7:155163787-155163809 TGGCTCACAGCACTGTGATGAGG - Intergenic
1034965296 7:155387122-155387144 ACCCTCACAGATGTGTCCTGAGG - Intronic
1034982764 7:155489353-155489375 TGCCTCACAGAGCTGTGGTGAGG - Intronic
1035525808 8:312250-312272 TGACTCACACAAATGTCATTTGG + Intergenic
1035855182 8:2966734-2966756 TGCCTAACAGCCGTGTCCTGTGG - Exonic
1036586879 8:10132684-10132706 TGTCTCACAGGACTGTCATTGGG - Intronic
1037732956 8:21544718-21544740 CACTTCACAGGAGTGTCATGAGG - Intergenic
1037887771 8:22604090-22604112 TACCTCACAGACTTGTTATGAGG + Exonic
1038271093 8:26076597-26076619 TGCCTCATAGGATTGTCATGAGG - Intergenic
1038444807 8:27595905-27595927 TGCATCAGATAAGTGTCTTGGGG - Intergenic
1038988848 8:32843995-32844017 TACCTCACAAAATTATCATGAGG + Intergenic
1039436456 8:37562737-37562759 TGCCCCACAGAAGAGTTGTGTGG - Intergenic
1039463060 8:37762344-37762366 TGCCTCACAAAAGTCCCTTGGGG + Intergenic
1039493259 8:37963674-37963696 TACCTCACAGCAGTGTCAGAAGG - Exonic
1041258355 8:55998689-55998711 AGCCTAACAAAAGTATCATGTGG - Intronic
1041566152 8:59281195-59281217 AGACTAACAGAAGAGTCATGAGG + Intergenic
1044516840 8:93148827-93148849 TTCCTCAAAGAAATGTCATGAGG - Intronic
1045005266 8:97911947-97911969 TGCCTCATAGGGTTGTCATGAGG - Intronic
1045240013 8:100391897-100391919 TGCCTCTCAGCAGAGTGATGAGG - Intronic
1045683305 8:104685772-104685794 TGCCTCACGGAAGAGTCACAAGG - Intronic
1046030052 8:108772884-108772906 TACCTCACAGGATTGTCATGGGG + Intronic
1046191189 8:110796044-110796066 TGCCTCATAGAACTTTTATGAGG + Intergenic
1046474109 8:114718250-114718272 TGCATGACAGAAGTTTCTTGAGG + Intergenic
1046723549 8:117650300-117650322 TGCCTCAGAGAATTGTTCTGGGG + Intergenic
1047286309 8:123490172-123490194 TGCGTCACAGAATTGCCATGAGG - Intergenic
1049742727 8:144248811-144248833 TGCCTAACAGAAGTGGCGTTGGG + Intronic
1049890005 9:59866-59888 TGCCTCACAGATGTGTCTGCAGG - Intergenic
1050074363 9:1848099-1848121 TGGCTCACAGAAGAGTGCTGGGG - Intergenic
1051479727 9:17546253-17546275 TGCCTCATAGAATTGTTTTGAGG + Intergenic
1051565234 9:18489937-18489959 TGCCTCATAGTAGTATTATGAGG + Intronic
1051603102 9:18893754-18893776 TGTCTCACAGGAGTGGAATGTGG - Intronic
1051686234 9:19660833-19660855 TGTCTCATAAAAGTTTCATGAGG - Intronic
1051729351 9:20123631-20123653 TGCCTCATAGGATTGTCATGTGG + Intergenic
1052105276 9:24507174-24507196 TTCCTCACAGGAGTGCAATGAGG - Intergenic
1052892741 9:33719389-33719411 TACCTTCCAGAAGTGTCACGGGG + Intergenic
1053418403 9:37961294-37961316 TAACTCACAGAAGTTTCATGTGG + Intronic
1053731484 9:41061141-41061163 TGCCTCACAGATGTGTCTGCAGG - Intergenic
1054697027 9:68370954-68370976 TGCCTCACAGATGTGTCTGCAGG + Intronic
1054739047 9:68786334-68786356 TGCCTCACAGGGTTGTCATGAGG - Intronic
1056246128 9:84697254-84697276 TGCCTCACAGGAATCTCACGAGG - Intronic
1057123053 9:92594458-92594480 TGCCTCATAAAGGTGTTATGAGG + Intronic
1057885437 9:98826196-98826218 TGCCTCAGAGGATTGTTATGAGG + Intronic
1058453268 9:105116356-105116378 ATCCTGACAGAAGAGTCATGTGG - Intergenic
1058568397 9:106312274-106312296 TACATCACAGAAGTGTTATAAGG + Intergenic
1059623690 9:116037090-116037112 TGCCCCACACAATTGTAATGTGG + Intergenic
1060607747 9:124932554-124932576 TGCCTCACAGAGCTGTGATGAGG + Intronic
1060698170 9:125728047-125728069 TTCCTCATAGGACTGTCATGAGG + Intergenic
1060877981 9:127096886-127096908 TACCTCACAGGAGTGTCAGGAGG - Intronic
1187630213 X:21161069-21161091 TGCCTCAAAGAATTTTTATGAGG - Intergenic
1188278495 X:28232969-28232991 GGCCTCACACATGTGTCTTGTGG + Intergenic
1189064991 X:37797932-37797954 TGCCTCTCAGGCTTGTCATGAGG + Intronic
1189212640 X:39297049-39297071 TGCCTCATAGGAGTGTTACGAGG - Intergenic
1189611620 X:42742472-42742494 TACCTCACAGTATTGTTATGAGG - Intergenic
1190505634 X:51123507-51123529 TGCCTCACAGGAAAGTCATGGGG - Intergenic
1190733517 X:53240128-53240150 TACTTCACAGGATTGTCATGAGG - Intronic
1191679732 X:63828964-63828986 TGCCTCACAGACGTGAACTGGGG + Intergenic
1192087391 X:68114260-68114282 TACCTCACAGAGTTGTTATGAGG - Intronic
1192288208 X:69761429-69761451 TCCTTCACAGGAATGTCATGAGG - Intronic
1192808016 X:74526907-74526929 AGACTCACAGGGGTGTCATGTGG - Intronic
1193902517 X:87199717-87199739 TGTTTCACATAAGTGGCATGAGG + Intergenic
1195230220 X:102839477-102839499 TTCCTCACAGAACTGTTCTGTGG + Intergenic
1195553644 X:106196828-106196850 TTCCTCACATAATTGTCATCTGG + Intronic
1196187373 X:112758818-112758840 TATCTCACAGAGCTGTCATGAGG - Intergenic
1198055251 X:132987981-132988003 TGCCTCAAACAATTGTGATGTGG - Intergenic
1198092789 X:133348471-133348493 AGGCTCACAGAAGTGTGCTGGGG + Intronic
1198662506 X:138985079-138985101 TACTTCACAGAGGTGTCATGAGG - Intronic
1198781922 X:140247266-140247288 TGTCTCACAGTATTGTTATGAGG + Intergenic
1199396305 X:147342888-147342910 TGCCTCACATAACTGGCAGGTGG + Intergenic
1199661132 X:150052223-150052245 TGCCTCACAGGATTGTTGTGAGG - Intergenic
1199688138 X:150282468-150282490 TGCTTCACAGAATTGTTATATGG + Intergenic