ID: 999199627

View in Genome Browser
Species Human (GRCh38)
Location 5:149806471-149806493
Sequence CAGGAGAGACCGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 741
Summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 658}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999199627_999199638 20 Left 999199627 5:149806471-149806493 CCCTGCTCCCTCGGTCTCTCCTG 0: 1
1: 0
2: 6
3: 76
4: 658
Right 999199638 5:149806514-149806536 GGAAATAGAACCAGAGAACGTGG 0: 1
1: 0
2: 1
3: 17
4: 270
999199627_999199640 30 Left 999199627 5:149806471-149806493 CCCTGCTCCCTCGGTCTCTCCTG 0: 1
1: 0
2: 6
3: 76
4: 658
Right 999199640 5:149806524-149806546 CCAGAGAACGTGGACACTATAGG No data
999199627_999199633 -9 Left 999199627 5:149806471-149806493 CCCTGCTCCCTCGGTCTCTCCTG 0: 1
1: 0
2: 6
3: 76
4: 658
Right 999199633 5:149806485-149806507 TCTCTCCTGCCAGCCAGGGCAGG No data
999199627_999199635 -1 Left 999199627 5:149806471-149806493 CCCTGCTCCCTCGGTCTCTCCTG 0: 1
1: 0
2: 6
3: 76
4: 658
Right 999199635 5:149806493-149806515 GCCAGCCAGGGCAGGAGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999199627 Original CRISPR CAGGAGAGACCGAGGGAGCA GGG (reversed) Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901959013 1:12810016-12810038 CAGGAGGGAATGAGGGAGAATGG - Intergenic
902538962 1:17138868-17138890 CAGAGGAGACCACGGGAGCAAGG + Intergenic
902697351 1:18149287-18149309 CAGGGGAGACCATGGGAGCAGGG + Intronic
902825832 1:18973595-18973617 CAGGAGGCACGGAGGCAGCACGG - Intergenic
902837931 1:19058663-19058685 CAGGAGAGAGGGAGGGACCAGGG - Intergenic
903034077 1:20483814-20483836 GAGGAGAGGGCGAGGGAGCAGGG + Intronic
903078007 1:20787000-20787022 CAGGAGAGAGGAAGGGAGCGGGG + Intronic
903106408 1:21084363-21084385 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
903220123 1:21864847-21864869 CAGGACAGACCGATGTAGCCTGG + Exonic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905481881 1:38267627-38267649 AAGGAGAGACGGAGGGAAGAAGG - Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
907508359 1:54939147-54939169 CAGGAGAGAGTGTGAGAGCACGG + Intergenic
909344034 1:74564649-74564671 CAGGAGAGAGAGAGAGAGCAAGG + Intergenic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909663292 1:78107161-78107183 AAGGAGGGAGGGAGGGAGCAAGG - Intronic
909823463 1:80095921-80095943 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
910288251 1:85577284-85577306 CAGGAGAGCCCCAGGAAGCCAGG - Intronic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
912044429 1:105437023-105437045 CAGAGGAGACTGAGGCAGCAGGG - Intergenic
913053252 1:115135022-115135044 GTGGGGAGACCGAGGGATCAGGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916553594 1:165873819-165873841 CAGGAGGGAGGGAGGGAGAATGG - Intronic
916598148 1:166266202-166266224 CATGAGAAAACTAGGGAGCAAGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916662522 1:166935643-166935665 CTGGAGAGTCCGAGGGAGTGGGG - Intronic
916860660 1:168801092-168801114 CAGGAGAGGGAGAGAGAGCAGGG + Intergenic
916886951 1:169078710-169078732 AAGGAGAGACAGAGGGAACTAGG + Intergenic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918532604 1:185539695-185539717 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
918683633 1:187387638-187387660 CAAGAGAGAGAAAGGGAGCAAGG + Intergenic
918956851 1:191218733-191218755 CAGGAGAGACACAGAGAGAAAGG + Intergenic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
919846955 1:201648502-201648524 GGGGAGAGAGCGAGGGAGGAGGG - Exonic
919918248 1:202152473-202152495 CAGGAGAGACCCAGGGGGCAGGG + Intronic
919925517 1:202189933-202189955 GAGGAGAGAGCAAAGGAGCAGGG - Intergenic
920050154 1:203159576-203159598 CAGGAGAGAGTGAGTGGGCAGGG - Intronic
920094234 1:203475667-203475689 GAGGAGAGAGGGAGGGAGCTTGG - Intergenic
920616023 1:207493507-207493529 CAGGAGAGACGGAGGTTTCATGG + Intergenic
920618947 1:207525055-207525077 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920620727 1:207543611-207543633 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920622509 1:207562168-207562190 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
921184111 1:212655565-212655587 CATGAGGGCTCGAGGGAGCAGGG + Intergenic
921297900 1:213722001-213722023 CAGAAGAGACGGAGTGGGCACGG - Intergenic
922081350 1:222300278-222300300 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
922183470 1:223254410-223254432 CAGGAGAGACAGAGGGTTAATGG + Intronic
922349066 1:224721082-224721104 GAGGACAAACCGAGGCAGCACGG - Intronic
922456115 1:225774959-225774981 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
923459254 1:234194440-234194462 CAGGAGAGAGGGTGGGAGGAGGG + Intronic
923460770 1:234207413-234207435 CAGGAAAGAGGGAGGGAGAAAGG - Intronic
923633880 1:235675152-235675174 CAAGAAAGACCAAGGGAGCTTGG - Intronic
923799622 1:237194666-237194688 TAGGGGAGAGCGAGTGAGCAGGG + Intronic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063354937 10:5389180-5389202 CAAGAGAGATCAAAGGAGCAAGG + Intergenic
1063525282 10:6778981-6779003 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1063887847 10:10597730-10597752 CAGGAGAGGCCAAGGGATCAGGG - Intergenic
1064393240 10:14959494-14959516 CAGGAGAGGCCGGGGGCGCCCGG - Exonic
1064564160 10:16623173-16623195 CAGGTGGGAGAGAGGGAGCAAGG - Intronic
1065486076 10:26237529-26237551 GAGACGAGACAGAGGGAGCAGGG + Intronic
1065494979 10:26318554-26318576 AAGGAGAGAAAGAGGGAGAAAGG + Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1067799486 10:49349289-49349311 AAGGAGAGAGGGAGGGAGCCGGG + Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068803870 10:61172757-61172779 AAGGAGGGACGGAGGGAGGATGG + Intergenic
1069576945 10:69537507-69537529 CAGGAGAGAGGGCTGGAGCAAGG - Intergenic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1069859435 10:71461293-71461315 CAGGGGACTCCGAGGGAGAAAGG - Intronic
1070563911 10:77589436-77589458 GAGGAGAGGCCCAGGGAGCTTGG - Intronic
1070569949 10:77633333-77633355 AAGGAGAGAGAGAGAGAGCAAGG + Intronic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071867714 10:89755390-89755412 AAGGAGGGAGGGAGGGAGCAAGG - Intronic
1072218152 10:93305363-93305385 CAGGAGAGAGCGAGCAAACAGGG - Intergenic
1073062558 10:100741271-100741293 CAGGAGGGAGGGAGGGAGCGAGG + Intronic
1073077562 10:100834014-100834036 AAGGAGAGACAGTGGGTGCAGGG + Intergenic
1073741918 10:106417076-106417098 CAGGAGAGACAGAGTGTGAAGGG + Intergenic
1073859512 10:107721572-107721594 CAGGAGAGAGAGAGAGAGCAGGG - Intergenic
1074115904 10:110457444-110457466 GAGGAGAGGCTGAGGGGGCACGG + Intergenic
1075010729 10:118867591-118867613 AAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075093290 10:119455161-119455183 CAGGGGAGACCCCGGGAGCCGGG + Exonic
1075769803 10:124923711-124923733 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
1076182406 10:128420520-128420542 CAGGAGAGAGAGAGGGCGCAGGG + Intergenic
1076260477 10:129060952-129060974 CAGGAGAGAGCGAGGAGGAATGG + Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076723845 10:132404442-132404464 CAGGACATACGTAGGGAGCATGG + Intronic
1076785576 10:132748203-132748225 TCGGAGAGACAGAGGCAGCAAGG - Intronic
1076799500 10:132814052-132814074 CAGGGCAGACCCAGGGAGCCGGG + Intronic
1077137175 11:1006270-1006292 CAGGAGGGGCCGAGGGAGGAGGG + Intronic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1077258315 11:1599771-1599793 GAGGAGAGAGCAAGGGGGCAAGG + Intergenic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1078285563 11:9951127-9951149 AAGGAAAGATTGAGGGAGCAGGG + Intronic
1078362918 11:10683550-10683572 CAGCAGAGAACCAGGGGGCAGGG - Intronic
1078451902 11:11446714-11446736 GAGAACAGACCGAGGGGGCAAGG - Intronic
1078827168 11:14940335-14940357 CAGGAGAGAGAGAGGGGGAAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080697654 11:34617037-34617059 CAGGCGAGACCAAAGGAACAGGG + Intergenic
1081045306 11:38266865-38266887 CAGGAGAGAGAGAGGATGCAGGG - Intergenic
1082013295 11:47465566-47465588 CAGCAGAGTCCTAGGGAGCAGGG + Intergenic
1082171974 11:49015735-49015757 CAGGACAGACCGCTGGAGCTTGG + Intergenic
1082838462 11:57668483-57668505 CCGCAGAGCCCGAGGGCGCAGGG - Intronic
1083711821 11:64554393-64554415 CTGGAGAGGCCGAGGAAGGAAGG + Intergenic
1083755950 11:64791846-64791868 CATGAGAGACCGAGGGAGGGAGG - Intronic
1084516622 11:69641213-69641235 CAGAAGAGCGCGAGGGAGCGCGG + Exonic
1085299518 11:75450078-75450100 CAGGAGAGGCCGATGGAGCAGGG + Intronic
1085472397 11:76766711-76766733 CAGGAGGGTCCCAGGGAGGATGG - Intergenic
1085707110 11:78796316-78796338 CAGGAAAGAACTAGTGAGCAAGG + Intronic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1086395436 11:86410565-86410587 AAGGAGAGAGCGAGCGAGCATGG + Intronic
1086486647 11:87310477-87310499 GAGGAGGGAGGGAGGGAGCAGGG + Intronic
1087496053 11:98891823-98891845 CAGGAGAGAGGGAGGGTGAAGGG + Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087805271 11:102548538-102548560 GAGGAGAAATGGAGGGAGCAAGG + Intergenic
1088249135 11:107847708-107847730 CAGGAGGGACAGAGGAAACAGGG + Intronic
1088321925 11:108563371-108563393 CAGGAGAGGCTGAGGAGGCATGG + Intronic
1088763016 11:112950004-112950026 GAGGTGAGACTGAGAGAGCAGGG + Intergenic
1088920275 11:114255516-114255538 CAGGAGAGAGGGAGAGAGAATGG - Intergenic
1089302788 11:117508590-117508612 TAGGAGGGACCAAGGGACCAAGG - Intronic
1089337398 11:117734588-117734610 CAGGAGAGAATGGGGGTGCAGGG - Intronic
1089648739 11:119897766-119897788 CAGGAAAGAAAGAGTGAGCAGGG - Intergenic
1090350188 11:126103022-126103044 CAGCAGAGACCGAGAGAGGCAGG + Intergenic
1090398498 11:126434263-126434285 CAGGAGCCACCGAGGGGGGAAGG + Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090631998 11:128657583-128657605 CAGGAGAGCCTGAGGTGGCAAGG - Intergenic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091351716 11:134903202-134903224 CAGGAGTGAATGAGGGAGCAAGG + Intergenic
1091689851 12:2588451-2588473 CAGGAGAGAGGGAGAGGGCAGGG - Intronic
1091754114 12:3040699-3040721 CGGGAGGGACTGGGGGAGCAAGG + Intergenic
1091780809 12:3213520-3213542 CAGGAGAGAGCAAGGGTGGAGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092079903 12:5707197-5707219 CAGGAGAGAGAGAGAGTGCAGGG - Intronic
1092310438 12:7345881-7345903 CAGGAGTGAAAGAGAGAGCAGGG + Intergenic
1092530673 12:9342150-9342172 CAGCTGAGACCGAGGGTGCCGGG - Intergenic
1093140618 12:15506583-15506605 CAGGACAGAGAGAGAGAGCAGGG + Intronic
1093420353 12:18967516-18967538 CAGGTGAGGCCCGGGGAGCATGG + Intergenic
1094677200 12:32632489-32632511 GAGGAGAGAGGCAGGGAGCATGG + Intronic
1094724150 12:33095364-33095386 CAGGAAAGAGAGAGAGAGCAAGG + Intergenic
1094818473 12:34207828-34207850 AGGGAGAGACCGAGGGAAGATGG - Intergenic
1095188718 12:39231557-39231579 CAGAAGAGAGAGAGAGAGCAAGG - Intergenic
1095211272 12:39497975-39497997 GAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1095386198 12:41653531-41653553 CAGGAGAGAAAGAGAGAGAAAGG + Intergenic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1096532396 12:52250048-52250070 CAGGGGAGAGGGAGGGAGCCAGG + Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098407711 12:70143189-70143211 CAGGAGAGACAGAGTGCGCAGGG - Intergenic
1098521008 12:71435628-71435650 CAGGAGAGAGAGAGGGTGAATGG + Intronic
1098715313 12:73822428-73822450 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099219143 12:79891740-79891762 CAGGAGAGAGCAAGAGAGGAGGG - Intronic
1099227514 12:79987235-79987257 CAGGAAAAAACGAGGGAGTAAGG - Intergenic
1099418892 12:82427741-82427763 CAGGCGAAACCCAGGGAACAAGG - Intronic
1099784161 12:87238766-87238788 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1100471250 12:94895214-94895236 CAGAAGGGAGAGAGGGAGCAAGG - Intergenic
1100569812 12:95837200-95837222 CAGGAGAGAGAGAGGGAGAGAGG + Intergenic
1101303415 12:103504144-103504166 CAGGAGTGACCCCGGCAGCATGG + Intergenic
1101946726 12:109143000-109143022 CAGGAGGGACAGAGGGATCTTGG + Intronic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1103346979 12:120257669-120257691 CAGGAGGGACCAAGGGAGTGGGG + Intronic
1103540350 12:121661886-121661908 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1104070919 12:125344660-125344682 AAGGAGAGAGCAAGGGAGCAGGG + Intronic
1104191072 12:126482426-126482448 GAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1104753349 12:131253812-131253834 CAGGAGAGAGAGAGCGAGTAGGG - Intergenic
1104811887 12:131624285-131624307 GTGGACAGAGCGAGGGAGCAGGG + Intergenic
1104821733 12:131681169-131681191 CAGGAGAGAGAAAGAGAGCAGGG + Intergenic
1105783040 13:23721014-23721036 CAGGAGAGAACGAGTGAGGGGGG + Intergenic
1105831280 13:24164844-24164866 GAGGAGAGACCAGGGGACCAGGG + Intronic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1108069646 13:46615315-46615337 CAAGAGAGAGCAAGGGAGGAGGG + Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108735615 13:53280763-53280785 GAGGAGAGAACCAGGGATCAGGG - Intergenic
1108770838 13:53698989-53699011 CAGGAGAGAGAGAGCGTGCAGGG - Intergenic
1108907138 13:55490553-55490575 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1109299062 13:60571823-60571845 CAGGAGATACCTAGGAATCAGGG + Intronic
1111231884 13:85354490-85354512 CAGGAGAGACCCACAGACCAAGG - Intergenic
1111567787 13:90039238-90039260 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1112306031 13:98274404-98274426 CAGAAGAGACTGAGGGAGGAAGG + Intronic
1112367687 13:98769716-98769738 CAAGAGAGAGAGAGAGAGCAGGG + Intergenic
1112718922 13:102219411-102219433 CAGTAGAAATCTAGGGAGCAGGG - Intronic
1112827930 13:103413622-103413644 CAGGAGGGAGAGAGAGAGCAGGG - Intergenic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113365733 13:109674125-109674147 CAGGAGAGAGAGAGCGTGCAGGG - Intergenic
1113615156 13:111675333-111675355 CAGGGGCTTCCGAGGGAGCAGGG - Intergenic
1113620623 13:111760246-111760268 CAGGGGCTTCCGAGGGAGCAGGG - Intergenic
1113693068 13:112325703-112325725 GAGGAGAGAGAGAGGGAGCTCGG - Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1114701437 14:24682351-24682373 AAAGAGAGAGCAAGGGAGCAGGG - Intergenic
1114773551 14:25455932-25455954 AAGGAGAGAAGGAGGGAGCGAGG - Intergenic
1114778394 14:25512491-25512513 CAGGAGAGAGAGAGTGAGCAAGG + Intergenic
1115755665 14:36524479-36524501 CGGGAGGGACCGCGGGAGCCCGG + Intergenic
1116789592 14:49326488-49326510 CAGGAGAGACAGAGTAGGCAGGG - Intergenic
1116998117 14:51345594-51345616 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
1117229273 14:53698762-53698784 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1117758110 14:58997685-58997707 CAGGAGAGAGCGAGTGTGAAGGG - Intergenic
1117794640 14:59379714-59379736 CAGGAGAGTCAGAGGGAGAGAGG + Intergenic
1118312530 14:64704428-64704450 CAGGAGGGAGCGAGGGAGCGAGG - Exonic
1118634746 14:67737420-67737442 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
1118873590 14:69764276-69764298 CAGGAGAGAGAGAGAAAGCAAGG - Intronic
1120263656 14:82221059-82221081 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1120970671 14:90204533-90204555 CAGGGAAGAGCCAGGGAGCAGGG - Intergenic
1121054156 14:90839275-90839297 CTGGAGAGACCTAGGGATGAAGG + Intergenic
1121328864 14:93037086-93037108 CAGGAGCCACCCAGGGAGCAGGG - Intronic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1122115757 14:99526521-99526543 GAGGTGAGACCCAGGGAGCAAGG + Intronic
1122926911 14:104907808-104907830 CAAGAGTGAAGGAGGGAGCAGGG + Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1126261754 15:46701413-46701435 GAGGAGAGACAGAGCGAGAAGGG - Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128192648 15:65717972-65717994 CAGCAGAGACCGAGAGATGATGG - Exonic
1128768756 15:70266608-70266630 CACGAGAGAGGGAGGGAGCTTGG - Intergenic
1128865958 15:71115432-71115454 GAGGAAGGACCGAGGGAGCGCGG + Exonic
1129676080 15:77632931-77632953 GAGGAGGGATCGAGGGAGGAGGG + Intronic
1130064263 15:80591758-80591780 CGGCAGAGACCGAGGGGGAAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130228266 15:82076538-82076560 GAGGAGAGACTCAGGGACCAGGG - Intergenic
1130967083 15:88705510-88705532 AATGAGAGCCCGAGGGAGCCCGG - Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131597520 15:93813325-93813347 CAGGAAACACCCAGGCAGCAGGG + Intergenic
1131613582 15:93989975-93989997 CAGGAGAGTCCAAGAGACCATGG + Intergenic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132738704 16:1400025-1400047 CAGGGGAGGCTGAGGGGGCAGGG + Intronic
1132865913 16:2092656-2092678 CACCAGAGACCCAGGGAACATGG + Intronic
1133033181 16:3021223-3021245 CAGGAGCTGCCGCGGGAGCAGGG - Exonic
1133758649 16:8781035-8781057 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134252599 16:12584979-12585001 CATGAGAGACTGAAGGAGCAGGG - Intergenic
1134419990 16:14077994-14078016 CAAGAGAGACTAAGGCAGCAAGG - Intronic
1135082666 16:19449812-19449834 CAGGAGAGAGAGTGGGTGCAGGG - Intronic
1135117711 16:19737715-19737737 GGGGAGAGACGGAGGGAGAAAGG - Intronic
1135138889 16:19905063-19905085 AAGGAGAGAGGGAGGCAGCAAGG + Intergenic
1137014078 16:35356409-35356431 CAGGAGAGAGAGAGAGAGAAAGG + Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1139574193 16:67831020-67831042 TGGGAGACACCGAGGGACCAAGG + Intronic
1140242604 16:73217139-73217161 CAGATGAGTCAGAGGGAGCAGGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1141411250 16:83834638-83834660 CAGGAGAGACAGAGAAAGCCCGG - Intergenic
1141812337 16:86383785-86383807 AAGGAGGGACAGAGGGAGAAAGG + Intergenic
1142381140 16:89732890-89732912 CAGCAGAGGGCGAGGGCGCAGGG - Intronic
1142381166 16:89732998-89733020 CAGCAGAGGGCGAGGGCGCAGGG - Intronic
1142381176 16:89733043-89733065 CAGCAGAGGGCGAGGGCGCAGGG - Intronic
1142683980 17:1566682-1566704 GAGGACGGACAGAGGGAGCAAGG - Intergenic
1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG + Intronic
1142812268 17:2400849-2400871 CAGGGAAGAACGGGGGAGCACGG + Exonic
1143071202 17:4294993-4295015 AAGGAGAGACGGAGGGAGGGAGG + Intronic
1143989804 17:10947358-10947380 CAAGAGAGACCAAGAGTGCAAGG + Intergenic
1144085762 17:11807216-11807238 CAGGAGAGAAACAGGGAGCCCGG - Intronic
1144628225 17:16856424-16856446 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145159817 17:20566991-20567013 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145242699 17:21249014-21249036 CAGGAGGGGCAGAGAGAGCATGG - Intronic
1146176085 17:30667479-30667501 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146349543 17:32083589-32083611 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146896531 17:36545420-36545442 CGGGAGAGAGGGAGGGAGCGCGG + Intronic
1146963075 17:37001334-37001356 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147458885 17:40555979-40556001 CTGGAGAGGCCGAGGCTGCAGGG - Intronic
1148046964 17:44750142-44750164 GAGGAGGGAGCGAGGGAGGAGGG - Intronic
1148116497 17:45178359-45178381 CAGGAGAGAGCCTGGGAGGAAGG - Intergenic
1148185523 17:45640664-45640686 CAGGAGAGACCCAGAAAACAGGG + Intergenic
1148962106 17:51401921-51401943 AAGAAGAGAATGAGGGAGCAGGG + Intergenic
1149075505 17:52593097-52593119 AAGGAGAGACAGAGAGACCAGGG - Intergenic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151009267 17:70474525-70474547 CAGGAGACAGAGAGAGAGCAAGG + Intergenic
1151350692 17:73530331-73530353 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
1151787472 17:76282123-76282145 CAGGAGAGACGGCAGCAGCAGGG + Intronic
1152650606 17:81490850-81490872 GAAGAGAGACCCAGGGGGCAAGG - Intergenic
1152813002 17:82391066-82391088 GAGGAGGGACCGAGGCAGGAGGG + Intronic
1152818179 17:82421185-82421207 CAGGGGAGGCCGAGGCTGCAAGG + Intronic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154371043 18:13763489-13763511 CAGGAGAAGTCCAGGGAGCAGGG - Exonic
1154498610 18:14981054-14981076 CAGGAGAAACCAAGGGAGGCAGG - Intergenic
1155463909 18:26114579-26114601 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1155617364 18:27737673-27737695 CAGGAGAGAGAGAGAGGGCAGGG + Intergenic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1157386369 18:47262232-47262254 TATGAGAGAAGGAGGGAGCAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1158106566 18:53891344-53891366 CAGGAAAGACAGAGGAAACAAGG + Intergenic
1158696670 18:59709824-59709846 CAGGAGAGAGGGAGGGTCCAGGG + Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160560268 18:79751347-79751369 CAGGAGGGAAGGAGGGAGCGGGG + Intronic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1163105827 19:15122642-15122664 CAGGAGAGAACGGGGGATAAAGG + Intronic
1163216788 19:15885080-15885102 AAGGAGAGAGAGAGAGAGCAGGG - Intronic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1163694804 19:18758736-18758758 CAGGGGAGACCCAGGAAGCTTGG - Intronic
1164415377 19:28042823-28042845 CAGGAGAGAGGGAGGAAGCAGGG + Intergenic
1164519929 19:28971265-28971287 CAGAAGAGAGGGAGGCAGCAGGG + Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164783093 19:30909316-30909338 AAAGAGAGAGGGAGGGAGCAAGG + Intergenic
1164859837 19:31554185-31554207 AAGGAGAAACCGAGGCAGCCAGG - Intergenic
1165097269 19:33416520-33416542 CAGGTGAGCAGGAGGGAGCAGGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165742007 19:38210322-38210344 CAGGAGAGAGGAAGGGAGCAGGG - Intergenic
1165992156 19:39822570-39822592 CAGGAGAGACCTAAAGAGGAAGG + Intergenic
1166231435 19:41427476-41427498 CAGGAGAGAGGGAGGGAGGGAGG + Exonic
1166475347 19:43119671-43119693 AGGGAGAGAGGGAGGGAGCAAGG - Intronic
1166573109 19:43811720-43811742 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1166790366 19:45395599-45395621 GAGGGGGGACCCAGGGAGCATGG + Exonic
1167448710 19:49554855-49554877 CAGGGGAGAGTGAGGGAGCCAGG - Intergenic
1167647610 19:50714124-50714146 CAGGACAGAGCTGGGGAGCAGGG - Intronic
1168465002 19:56595047-56595069 GAGAAGAGACGGAGGGAGGAAGG - Intergenic
1168714459 19:58518880-58518902 CAGTAGAGCCCGAGGGTGTAGGG - Intronic
1202648696 1_KI270706v1_random:161997-162019 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925832424 2:7909629-7909651 CAGGAGAGAGAGAGAGAGAAGGG + Intergenic
926083006 2:10004000-10004022 CAGGAAAGACGGGGAGAGCAGGG + Intergenic
926449337 2:12983302-12983324 CAGAAGAGAAAGAGAGAGCAGGG - Intergenic
926629414 2:15123169-15123191 AAGGAGAAACTGAGAGAGCATGG - Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927083411 2:19652368-19652390 GAGGAGAGACAGTGGTAGCAAGG - Intergenic
927579682 2:24230902-24230924 CAGGAGAGAAGGAGGAAGCGAGG - Intronic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927699516 2:25259041-25259063 TGGGAGAGAACGAGGGAGCCAGG - Intronic
927829796 2:26339640-26339662 CATGAGAAACAGAGGGACCATGG - Intronic
928823589 2:35392012-35392034 CAGAGGAGGCCGAGGCAGCAGGG + Intergenic
929124003 2:38506543-38506565 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
929384965 2:41395662-41395684 CAGGAGAGAAAGAAAGAGCAAGG + Intergenic
929475448 2:42242646-42242668 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
929588679 2:43131637-43131659 CAGCAGGGACTGAGGGAGAAGGG - Intergenic
930299348 2:49594971-49594993 GAGGAGAGAGAGAGGTAGCAGGG - Intergenic
930836775 2:55802579-55802601 CAGGAGGGAACGAGTGAGCAGGG - Intergenic
931845287 2:66197572-66197594 CAGGAGATACCCAGGGTGAAGGG + Intergenic
932119922 2:69088971-69088993 CAGGATAGACTTAGGGACCAGGG + Intronic
932322971 2:70835392-70835414 CAGGAGAAACCCGGAGAGCAGGG + Intronic
933425717 2:82109743-82109765 CAGGAGAGAGGGAGGGTGAAGGG + Intergenic
933651272 2:84852296-84852318 CAGGACAGACCAATGCAGCAAGG + Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934606621 2:95700080-95700102 GAGGAGAGAGAGAGGGACCAGGG - Intergenic
934883117 2:98000485-98000507 CAGCAGAGAACCAGGGAGAAGGG - Intergenic
935603595 2:104947474-104947496 CGGGAGATACCCAGAGAGCACGG + Intergenic
935606811 2:104979915-104979937 CGGGAGATACCCAGAGAGCACGG + Intergenic
935933625 2:108156961-108156983 AAGGAGAGAGGGAGGGAGAAAGG + Intergenic
936090742 2:109499930-109499952 CAAGAGAGAATGAGGGAGCAGGG + Intronic
936105896 2:109624077-109624099 CAAAAGAGGCCAAGGGAGCATGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936540026 2:113342209-113342231 GAGGAGAGAGAGAGGGACCAGGG - Intergenic
936736054 2:115445075-115445097 CAGGAAAGAGAGAGAGAGCAGGG - Intronic
936736390 2:115447650-115447672 CAGGAAAGACCAAGAGAGCAGGG - Intronic
938122147 2:128641548-128641570 AAGGAGAGACAGAGGCACCAGGG + Intergenic
938241550 2:129746069-129746091 CAGGAGAGAGAGAGAGCGCAGGG - Intergenic
938541461 2:132287028-132287050 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939570485 2:143834350-143834372 AAGGAGAGAGCGAGGGAGACTGG - Intergenic
940786872 2:157990624-157990646 CAGGAGAGAACTCAGGAGCATGG - Intronic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
942260412 2:174155750-174155772 AAAGACAGACCGAGAGAGCAGGG + Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944159384 2:196642617-196642639 CAGGAGAGTCCTTGGAAGCAAGG - Intronic
944369065 2:198960620-198960642 CAGGAGAGAGAGAGTGTGCAGGG - Intergenic
945120929 2:206456236-206456258 CAGGAGAGAGAGAGCAAGCAAGG + Intronic
945475054 2:210272239-210272261 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
945763985 2:213950629-213950651 AAGGAGAGAGGGAGGAAGCAAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946130273 2:217601261-217601283 AAGCAGAGAGAGAGGGAGCAAGG - Intronic
946294648 2:218774244-218774266 TAGGAGAGACAGAGAGAGAAAGG + Intergenic
946431403 2:219628780-219628802 CAGGGGAGATCTAGGGAGCTGGG + Intronic
946438041 2:219672139-219672161 CAGGAGAGACAGAGCAAGCGGGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
946999857 2:225441617-225441639 CAGGAGAGAGAGAGTGTGCAGGG + Intronic
947111203 2:226721403-226721425 CAGGAGAGCTGGAGGGAGCAAGG + Intergenic
947159084 2:227193869-227193891 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947159101 2:227193936-227193958 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947527682 2:230889229-230889251 CAGGAGAGAGAGAGAGAGCACGG + Intergenic
947998014 2:234544777-234544799 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
947998723 2:234549709-234549731 AAGGAGAGAAGGAGGGAGAAAGG - Intergenic
948178556 2:235962358-235962380 CAGGAGAGATGGTGGGAGAAGGG + Intronic
948338254 2:237228336-237228358 CAGGAGAAAAGGAGGGAGTATGG + Intergenic
1169016451 20:2296696-2296718 CAGGAGAGCACCAGGGAACAGGG + Intronic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169030036 20:2399934-2399956 AATGAGAGACAGAGGGAGCTAGG - Intronic
1170129470 20:13003063-13003085 CAGGAAAGAGAGAGAGAGCAGGG + Intergenic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171870353 20:30520050-30520072 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1173199496 20:40944162-40944184 CAGGAGAGGCGGAGGGAGGGAGG - Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173431240 20:42988672-42988694 CAGGAGAGACAGTGGCTGCAGGG + Intronic
1173616127 20:44403956-44403978 GAGGAGAGGCCGAGGGAGAAAGG + Intronic
1174187893 20:48719982-48720004 AGGGAGAGAGCGAGGGAGTAAGG - Intronic
1174511494 20:51056889-51056911 CAGGAGAGACCCATGTGGCAAGG + Intergenic
1175146383 20:56899581-56899603 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1175503226 20:59464932-59464954 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1175653455 20:60748936-60748958 CAGGCGGGACAGAGGGGGCATGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176603155 21:8810691-8810713 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1176612032 21:8992087-8992109 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1177275686 21:18910239-18910261 CAGGTGAGAGAGAGTGAGCATGG - Intergenic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1177763863 21:25434293-25434315 CAGGAGATACCCAGGAAACAGGG + Intergenic
1177803376 21:25849608-25849630 CAGGAGAGAGAGACGGTGCAGGG - Intergenic
1178043934 21:28673030-28673052 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1178140248 21:29674653-29674675 CAGAAGAGAGAGAGAGAGCAAGG - Intronic
1178566210 21:33688727-33688749 GAGGAAAGACAGAGGGAGCTTGG + Intronic
1178697942 21:34810075-34810097 TGGGAGAGGCCGAGGGGGCATGG + Intronic
1179126399 21:38595036-38595058 CAGGAGAGCCCGAGGCAAGAGGG + Intronic
1180345441 22:11702248-11702270 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1180352277 22:11815064-11815086 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
1180353214 22:11820489-11820511 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1180385027 22:12171868-12171890 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
1180385931 22:12177002-12177024 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1180941331 22:19661299-19661321 CAGGAGAGAGCCAGGGAGAGAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181487296 22:23239398-23239420 GAGGAGAGCCCAAGAGAGCACGG + Intronic
1181982533 22:26775604-26775626 CAGGAGAGCCAGAGGGTGCCAGG + Intergenic
1182089083 22:27581791-27581813 CAGAAGAGGCAGAGGGAGCGCGG + Intergenic
1182208837 22:28656210-28656232 CAGGAGAGGCCCAAGGAGCCTGG + Intronic
1182748072 22:32621140-32621162 CTGGTGAGCCCAAGGGAGCATGG - Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
1184599422 22:45533737-45533759 TAGGAGAGACCGAGGCAGTGCGG - Intronic
1184737626 22:46408794-46408816 GCGGAGACAGCGAGGGAGCATGG - Intronic
1185001443 22:48248941-48248963 AGGGAGAGACGGAGGGAGGAAGG - Intergenic
1185055662 22:48577147-48577169 CAGCAAAGACCAAGAGAGCAGGG - Intronic
1185174919 22:49321079-49321101 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174934 22:49321135-49321157 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174949 22:49321191-49321213 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
949647064 3:6107622-6107644 CAGGAGAGGCCAAAGAAGCAGGG + Intergenic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950670464 3:14522499-14522521 CTGGGGAGGCCGAGGGATCAGGG + Intronic
950959721 3:17092935-17092957 CAGGTGTGACCCAGGGACCAGGG + Intergenic
951033002 3:17903756-17903778 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
951641809 3:24844829-24844851 CAAGACAGACCTGGGGAGCAGGG - Intergenic
953072459 3:39534917-39534939 AAGGAGAGAGGGAGGGAGAAAGG - Intergenic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953273899 3:41475990-41476012 CAGGAGAGAAGGAGGGAAAAAGG + Intronic
953357462 3:42266747-42266769 AAGGAGAGACGGAGGGAGGGAGG - Intergenic
953818989 3:46188101-46188123 CAGGAGTGAGAGGGGGAGCATGG - Intronic
953880013 3:46686660-46686682 CAGCAGAGACCCAGAGAGCAGGG - Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955186751 3:56721606-56721628 CAGGAGAGAGTGAGAGAGCAAGG - Intergenic
955240876 3:57176977-57176999 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956796022 3:72719412-72719434 AAGGAGGGAGGGAGGGAGCAAGG + Intergenic
957173578 3:76773458-76773480 CAGGAAAGACCCAGGCAGAAAGG - Intronic
958152672 3:89710814-89710836 CAGTAGAGAGCAAGGTAGCACGG + Intergenic
958294906 3:91891390-91891412 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
958731830 3:97968157-97968179 CAGGAGACACCGCGGGTCCAGGG - Intronic
959485110 3:106919642-106919664 CAGGAGTTACAGAGGAAGCAGGG + Intergenic
959647946 3:108724283-108724305 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
960581315 3:119281607-119281629 CAGGAGAGAGAGAGTGGGCAGGG - Intergenic
960679324 3:120230719-120230741 CAGGAGAGAGAGAGTGTGCAGGG + Intronic
960959535 3:123060273-123060295 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
961136949 3:124520176-124520198 CAGGAGGGAATGAGGGAGCAGGG + Intronic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963854207 3:150237526-150237548 AAGGAGAGAAGGAGGGGGCATGG + Intergenic
964299228 3:155269761-155269783 CAGGAGAGACAGAGAGAGAGTGG - Intergenic
964791572 3:160458013-160458035 CAGGAGAGACCTACGGTGCCTGG - Intronic
965077170 3:163993786-163993808 CAAGAGAGAGAGTGGGAGCAGGG - Intergenic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966763985 3:183442299-183442321 CAGGAGAGAAAAAGGGAGTAGGG - Intergenic
967760966 3:193226053-193226075 CAGGAGAGAGCCAGGGAATAGGG - Intergenic
968000028 3:195199159-195199181 CAGGAGAGGCCGTGTGGGCAGGG + Intronic
968569360 4:1331403-1331425 CAGGAGAGCCCGGGGCAGCAGGG - Intronic
968612865 4:1564943-1564965 CACGTGGGACCCAGGGAGCAAGG - Intergenic
969122526 4:4920550-4920572 CAGGAGAGACTGAGGCACCCAGG - Intergenic
969402589 4:6965993-6966015 AAGGAGAGACCAATGGAGCTAGG - Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969683737 4:8657385-8657407 CTGGAGAGAACGCAGGAGCACGG + Intergenic
969723161 4:8904464-8904486 CAGGAGAGACAGAGAGAAAAGGG + Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970087096 4:12362034-12362056 CAGGAGAGACAGAGAGCACAGGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970354652 4:15239718-15239740 CAGGAGAGACCCAGGGACTTGGG - Intergenic
970758407 4:19453633-19453655 CAGGAGAGAGAGAGTGAGAAGGG - Intergenic
971245240 4:24921421-24921443 CAGGAGAGACCCAGTGGGCATGG + Intronic
971757097 4:30719630-30719652 TAGGAGAGAGCGAGGGAGGAGGG - Intergenic
971941779 4:33224773-33224795 CAGGAGAGATAGAGAGAGAAAGG - Intergenic
972281464 4:37605956-37605978 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
973374919 4:49279960-49279982 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
973375824 4:49285982-49286004 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
973376724 4:49292001-49292023 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
973377642 4:49298153-49298175 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
973378562 4:49304289-49304311 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
973380497 4:49317214-49317236 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
973381586 4:49324259-49324281 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
973382492 4:49330281-49330303 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
973612146 4:52645908-52645930 CAGGAGAGAGCAAGAGAGAAAGG - Intronic
973849354 4:54945918-54945940 CAGGAGAGGGCGAGAGGGCAAGG - Intergenic
973926862 4:55747778-55747800 GAGGAGAGACCAAGAGAGGAGGG + Intergenic
973978748 4:56288387-56288409 TAGGAGAGAGGGAGGGAGCGGGG - Intronic
974532281 4:63124375-63124397 TAAGAGAGACTGAGGGAGAAGGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
974923588 4:68271290-68271312 CAGGAGAGACAGAGCACGCAGGG + Intergenic
976283855 4:83351848-83351870 CAGGAGAGAATGAGGGTGAAAGG + Intergenic
976457558 4:85265850-85265872 CAGGAGAGAGAGAGCAAGCAAGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977763548 4:100771012-100771034 GAGGAGAGAGCGAGAGAGAAAGG + Intronic
977970125 4:103203285-103203307 CAGGAGAGTGAGTGGGAGCAGGG + Intergenic
978502155 4:109421031-109421053 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
980500632 4:133648254-133648276 GAGTAGAGAGAGAGGGAGCAAGG - Intergenic
980651927 4:135727747-135727769 CATGAAAGACCAAGTGAGCATGG - Intergenic
981128633 4:141133555-141133577 AAAGAGAGACCAAGGGAACATGG - Intronic
981738570 4:147978561-147978583 CAGGAGAGAGTGAGCAAGCAAGG - Intronic
983306728 4:165999417-165999439 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
983691044 4:170469578-170469600 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
983939803 4:173527235-173527257 GAGGAGAGCGCGAGTGAGCAGGG - Exonic
984594125 4:181648157-181648179 CAGAACAGACCAATGGAGCAGGG - Intergenic
985010191 4:185574068-185574090 CAGGAAACACCCAGGGAACAGGG + Intergenic
985219230 4:187685223-187685245 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
985487301 5:158679-158701 CAGGACAGGCAGAGGGAGGAAGG - Intronic
985616667 5:927011-927033 CAGGAGGGACCGGGCGAGCCTGG + Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
985894237 5:2739528-2739550 CAGGAGAGACCGGGGGGACCGGG + Intergenic
987367549 5:17162570-17162592 CAGGAGAGAGGGAGGGTGAAGGG + Intronic
987542925 5:19277884-19277906 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
987909276 5:24121459-24121481 CATGAGAGACAGAGAGAGCGAGG + Intronic
988136376 5:27176316-27176338 CAGGAGAGACAGAGAGCCCAGGG + Intergenic
988260957 5:28885715-28885737 CAGGAGAGAGAGTGAGAGCAAGG - Intergenic
988329372 5:29815178-29815200 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
989192588 5:38685844-38685866 AAGGAGAGACTTAGGGAACATGG - Intergenic
989782199 5:45281309-45281331 CAGGAGAGAGAGAGAGAGAAGGG - Intronic
990211932 5:53490213-53490235 CAGGAGATACTGGGGGAACAGGG - Intergenic
990868927 5:60409944-60409966 GAGGAGAGCCCGAGGGATGAAGG + Intronic
991204693 5:64037563-64037585 CAGGAGAGAGAGAGGGAGAGGGG - Intergenic
992250561 5:74871729-74871751 GGGGAGAGAGAGAGGGAGCAAGG + Intergenic
992575591 5:78107430-78107452 AAAGAGAGAGAGAGGGAGCATGG - Intronic
993251121 5:85524350-85524372 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
994084579 5:95744033-95744055 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
994088773 5:95789689-95789711 AAGGAGAGAGAGAGGGAGTAAGG + Intronic
994274887 5:97823439-97823461 AAGGAGGGAGGGAGGGAGCAAGG - Intergenic
995576183 5:113537450-113537472 CAGGGGAGACTGAGAAAGCATGG - Intronic
996412189 5:123170407-123170429 CAAGAGAGAGGGAGTGAGCAGGG - Intronic
997689468 5:135816077-135816099 CAGGAGAGAGAGAGCGTGCAGGG + Intergenic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
998172601 5:139881326-139881348 CAGGAGAGGCAGAGGCAGCTGGG - Intronic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
1000687474 5:164270208-164270230 CAGGAGAGAGGGAGGGAGGGAGG - Intergenic
1000789871 5:165592528-165592550 AAGGAGGGAGCGAGGGAGGAGGG + Intergenic
1001445542 5:171779852-171779874 AAGGAGAGAGAGAGGGAGAAGGG + Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1001920834 5:175598008-175598030 CAGGAGAGACCAAGGCAGAGGGG + Intergenic
1002334057 5:178466003-178466025 GAGGGGAGACTGAGGGACCAGGG - Intronic
1002639043 5:180621987-180622009 CAGGAGAGAGGGAGGGAGGGAGG - Intronic
1003016084 6:2468522-2468544 AGGGAGAGAGAGAGGGAGCAAGG + Intergenic
1003396389 6:5756495-5756517 CAGGAGAGAGAGAGAGAGCGAGG + Intronic
1003421410 6:5961526-5961548 CTGGAGAGACCATGGGAGCAAGG + Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003837128 6:10083857-10083879 AGGGAGAGACGGAGGGAGGAAGG + Intronic
1005203587 6:23375348-23375370 GAGGAGGGAGGGAGGGAGCAGGG - Intergenic
1005692609 6:28322044-28322066 CAGGAGTGACTGGGGGTGCATGG - Intergenic
1006116567 6:31779008-31779030 CAGGATAGCCCGAGGCAGCACGG + Exonic
1006445390 6:34076963-34076985 CAGGAGAGCCTTGGGGAGCAAGG + Intronic
1006970851 6:38043503-38043525 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007391373 6:41551403-41551425 CAGGAGAGAAGGAAGGTGCAGGG - Intronic
1007721020 6:43885530-43885552 CAGGAGAGTCCAGAGGAGCAAGG - Intergenic
1007748269 6:44056576-44056598 CAGGAGAGAGCGAGGGATCCTGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008378412 6:50817548-50817570 CAGGAGGGACCGAGGAGGGATGG - Intergenic
1009338902 6:62529295-62529317 CAGCAGTGACCCAGGGACCAAGG + Intergenic
1009527569 6:64765697-64765719 CAGGAGAGAAAGAAAGAGCAAGG + Intronic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1010771760 6:79839981-79840003 CAGGAGAGAGGGAGGGAGCCAGG + Intergenic
1011186102 6:84677070-84677092 CATAAGAGAATGAGGGAGCAGGG + Intergenic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011243964 6:85302143-85302165 CAGGACAAACTGAGTGAGCATGG + Intergenic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1012749577 6:103140528-103140550 CAGAAGGGGCCGAGGCAGCAGGG + Intergenic
1013587614 6:111593660-111593682 AGGGAGAGACGGAGGGAGGAGGG - Intronic
1014919838 6:127200853-127200875 TAGGAGAGACGGAGGGAGGGGGG + Intergenic
1015774074 6:136795901-136795923 CGGGAGGGAAGGAGGGAGCAAGG - Intergenic
1015859983 6:137665773-137665795 CAGGAGAGACGGAAGGGTCAAGG - Intergenic
1015972684 6:138758579-138758601 CAGAAGGGAGAGAGGGAGCAGGG - Intronic
1016268680 6:142261956-142261978 CAGGAGTGAGAGAGGGAGCAAGG - Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017159245 6:151349907-151349929 CAGGAGAGAATGAAGGTGCAGGG + Exonic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1019049042 6:169169392-169169414 GAGGAGAGAGCGGGGGAGGAAGG + Intergenic
1019303644 7:322239-322261 CAGGTGAGGCCGAGGCTGCACGG + Intergenic
1019382659 7:732550-732572 CAGGAGAGACTGGGGATGCATGG + Intronic
1019404719 7:877391-877413 AGAGAGAGACGGAGGGAGCAGGG - Intronic
1019522914 7:1468637-1468659 CATCTGAGACCGAGTGAGCACGG - Intergenic
1019632124 7:2055079-2055101 CAGCAGAGACAGAGGAAGCGGGG + Intronic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1021385803 7:20028296-20028318 CAGGAGAGAGAGAGGGAAAAGGG - Intergenic
1022032304 7:26503658-26503680 CAGGAGGGACCAAGGGCACAGGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022633402 7:32107349-32107371 AGGGAGAGAAGGAGGGAGCAAGG + Intronic
1022783443 7:33610512-33610534 CAAGAGAGAAAGAGGGAGTAGGG + Intergenic
1023830330 7:44035442-44035464 CAGAAGGGACTAAGGGAGCAAGG - Intergenic
1024920970 7:54554184-54554206 AAGGAGTGATCGAGGGAGAAAGG - Intronic
1026595747 7:71733022-71733044 AAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1026595764 7:71733070-71733092 AAGGAGGGAGGGAGGGAGCAAGG + Intergenic
1028437394 7:90820492-90820514 CAGGAGAGACAGAGCGAGGCAGG - Intronic
1028475081 7:91244565-91244587 CAGGAGATCCTGAGGCAGCAGGG - Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029740653 7:102489729-102489751 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1029758647 7:102588901-102588923 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030017024 7:105233045-105233067 AGGGAGAGAGGGAGGGAGCAAGG + Intronic
1031201521 7:118693858-118693880 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1031652209 7:124304473-124304495 GAGGAGAGACAGAGAGTGCAGGG - Intergenic
1032496285 7:132365298-132365320 TAGGAAAGACCGGGGGAGCAGGG - Intronic
1032560212 7:132883027-132883049 CAGGAGAGAGAGAGCGTGCAGGG - Intronic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033062127 7:138119252-138119274 AAGGAGTGACGGAGGGAGGAAGG + Intergenic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1033705206 7:143879870-143879892 CAGCAGAGGCTGAGGGAGAAGGG - Intronic
1034083860 7:148305655-148305677 CAGGAGAAAGCGAGTGAGCTGGG + Intronic
1034340908 7:150354423-150354445 CAGGAGAGACGGATGAAGCTGGG - Intergenic
1035070774 7:156143688-156143710 AAGGAGGGCCCCAGGGAGCAGGG + Intergenic
1035240621 7:157526911-157526933 CAGGAGAGCCACAGAGAGCACGG + Intergenic
1036028087 8:4933185-4933207 CAGAAGAGAGGGAGGGAGCAAGG - Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037337865 8:17809205-17809227 CAGAAGAGACAGAGAGGGCAGGG + Intergenic
1037706737 8:21321745-21321767 CAGGAGAGAACTAGAGAGCCAGG - Intergenic
1037806807 8:22062508-22062530 CAGGAAAGACTGAGGCTGCAGGG - Intronic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1038723391 8:30058234-30058256 CAGCACATACAGAGGGAGCATGG - Intergenic
1038723494 8:30058975-30058997 CAAGAGAGAGCGAGGGAGGGAGG - Intergenic
1038763946 8:30410280-30410302 CAGGAGAGGCTGAGGTTGCAGGG - Intronic
1039459246 8:37729517-37729539 CAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1039498288 8:37997624-37997646 AAAGAGAGACAGAGGGAGAATGG - Intergenic
1039798125 8:40932764-40932786 GACGAGAGACCGAGGAGGCAGGG - Intergenic
1040339645 8:46434012-46434034 CAAGAGAAAACGAGAGAGCAGGG + Intergenic
1042004870 8:64169237-64169259 CAGAAGGGGCCGAGGCAGCATGG - Intergenic
1042351644 8:67783346-67783368 CAGGAGAGACCACGGGAGAAAGG - Intergenic
1042887221 8:73565294-73565316 CAGGAGAGAGAGAGCAAGCAGGG - Intronic
1043702903 8:83313066-83313088 CAGAGGAGACCGAGGTGGCAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044606619 8:94053631-94053653 CAGGAGAGCAGGAGTGAGCAGGG + Intergenic
1044938095 8:97312518-97312540 CAGGAGAGACGAAGGGTCCAGGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045674098 8:104589082-104589104 CAGGCGAGCCGGAGGGAGGAGGG - Intergenic
1045873315 8:106950137-106950159 CAGAGGGGACCGAGGCAGCAGGG - Intergenic
1047379546 8:124346154-124346176 CAAGAGAGACAGAGCGTGCAGGG + Intronic
1048551692 8:135439075-135439097 AGGGAGAGAGGGAGGGAGCAAGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048802899 8:138210563-138210585 CAGAAGAGACAGAGAGAGTAAGG + Intronic
1048993849 8:139776918-139776940 CAGGAGCTACAGAGGGTGCAAGG - Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049576762 8:143393292-143393314 CCAGAGAGAAGGAGGGAGCAGGG - Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050282857 9:4069972-4069994 CAGGAGAGACCCAGGGAACATGG + Intronic
1050707192 9:8414868-8414890 CAGGAGAGAGGGAGGGAGGGAGG + Intronic
1051336617 9:16071434-16071456 CTGGAAAGTCTGAGGGAGCAAGG - Intergenic
1051342935 9:16128345-16128367 TAGGAGAGAAAGAGGGATCAAGG - Intergenic
1053519597 9:38764348-38764370 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
1053546903 9:39032671-39032693 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1053811222 9:41854324-41854346 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1054619372 9:67333115-67333137 CAGGAGAGAGAGAGAGAACAGGG + Intergenic
1054896026 9:70312284-70312306 CAGGAGAGAGAGAGTGGGCAGGG + Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056761369 9:89417786-89417808 GAGGAGAGGCCGAGAGAGCAGGG + Intronic
1056771840 9:89483209-89483231 CAGGCAAGACCAAGGGAGCCAGG + Intronic
1056780711 9:89548140-89548162 CAGAAGAGCCCGTGGGAGCTGGG - Intergenic
1058075344 9:100644917-100644939 AGGGAGGGACAGAGGGAGCAAGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1059184353 9:112253750-112253772 CAGGAGAGAGAGAGTGCGCAGGG - Intronic
1059750734 9:117244793-117244815 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1060571287 9:124642809-124642831 CATGAGAGAGGGAGGTAGCAGGG + Intronic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144060 9:134979105-134979127 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1062554921 9:137109630-137109652 CAGGGGAGAGCGAGGGGGCGTGG - Intergenic
1203480243 Un_GL000224v1:5102-5124 CAGGAGAGTCCCAGGGGGCTCGG + Intergenic
1203481211 Un_GL000224v1:11430-11452 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
1203482175 Un_GL000224v1:17739-17761 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
1203548737 Un_KI270743v1:151459-151481 CAGGAGAGTCCCAGGGTGCTGGG + Intergenic
1203549678 Un_KI270743v1:156946-156968 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1203550623 Un_KI270743v1:163111-163133 CAGGAGAGTCCCAGGGGGCTGGG - Intergenic
1203568203 Un_KI270744v1:109210-109232 CAGGAGAGTCCCAGGGGGCTGGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186051789 X:5604351-5604373 CAGGAGAGAGCGAGAGTGCAGGG + Intergenic
1186053462 X:5624583-5624605 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186369031 X:8927698-8927720 GAGGAGAGAGAGAGGGAGAAAGG - Intergenic
1187118941 X:16384523-16384545 GAGGAGAGAGGGAGGGGGCAGGG - Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1190823708 X:53997679-53997701 CAGGATGGACCCAGGGACCAAGG - Intronic
1191128682 X:56985175-56985197 AAGGAGAGAGTGAGGAAGCAGGG - Intronic
1191656433 X:63603887-63603909 CAGGAGAGAGAGAGGGCACAGGG - Intergenic
1191826570 X:65372465-65372487 CAGGAGAGAGGAAGGGAGGAAGG + Intronic
1191826597 X:65372607-65372629 CAGGAGAGAGGGAGAGAGGAAGG + Intronic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1195815404 X:108879360-108879382 CAGGAGAGAGTGAGTGAGCCAGG + Intergenic
1196402170 X:115328405-115328427 CAGGAGAGAGGGAGGGAGTTTGG - Intergenic
1197075317 X:122345739-122345761 CAGGAGAGAGACAGAGAGCAAGG + Intergenic
1197764985 X:130054429-130054451 AAGGAGAGAAGGATGGAGCAAGG + Intronic
1197769549 X:130081530-130081552 CAGGAGCGACCTAGAGAGAAGGG + Exonic
1197827241 X:130602809-130602831 GAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1198381622 X:136089169-136089191 AATGAGAGACAGAGGGAACAAGG + Intergenic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1200787799 Y:7274610-7274632 CCGGGGAGACCCAGGGCGCAAGG - Intergenic
1201696190 Y:16829102-16829124 GAGGAGAGACTGAGGGAGGGAGG + Intergenic
1201741219 Y:17326096-17326118 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic