ID: 999201551

View in Genome Browser
Species Human (GRCh38)
Location 5:149820360-149820382
Sequence TTATTGAGAGGGCCCCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999201547_999201551 2 Left 999201547 5:149820335-149820357 CCACGGGTCCAGATTAGCTGCAT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 78
999201546_999201551 8 Left 999201546 5:149820329-149820351 CCTTGGCCACGGGTCCAGATTAG 0: 1
1: 0
2: 0
3: 6
4: 58
Right 999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 78
999201548_999201551 -6 Left 999201548 5:149820343-149820365 CCAGATTAGCTGCATCATTATTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999201551 Original CRISPR TTATTGAGAGGGCCCCTGCT TGG Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
900584060 1:3424071-3424093 TTACTGAGAGGCACCCGGCTGGG - Intronic
900646462 1:3711011-3711033 TTGGTGAGAGGGACCCTGCATGG + Intronic
901315244 1:8302775-8302797 TTATTGAGGGAGCCCCTTCTTGG + Intergenic
904810826 1:33162472-33162494 CTAGTAAGTGGGCCCCTGCTGGG + Intronic
913214108 1:116605901-116605923 TTATTGAAAGGGCTACTGTTTGG + Intronic
1063351491 10:5360400-5360422 TAATTTACAGGGCCCCAGCTAGG - Intergenic
1065171308 10:23033289-23033311 CTATGGCGAGGGCCTCTGCTAGG + Intronic
1065231720 10:23605537-23605559 TTATTGAGAGGTTCTCTGATAGG + Intergenic
1071091227 10:81921100-81921122 TGTTTGAGAGTGCCCCTTCTTGG + Intronic
1075058641 10:119238843-119238865 TTCTTGAAAGGGTCCCTGTTTGG + Intronic
1079179438 11:18176103-18176125 TTATTGAGAGAGCCCATTCTGGG + Intronic
1081662095 11:44894521-44894543 TTAATCAGAGAGCCCCTCCTGGG + Intronic
1081841027 11:46201500-46201522 TTAGTGAGACAGCCCATGCTGGG - Intergenic
1085171868 11:74456540-74456562 ATGTTGCTAGGGCCCCTGCTAGG - Exonic
1087704692 11:101477079-101477101 TTACTGAGGGTGCCCCTTCTTGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1092850648 12:12623607-12623629 TGATAGAGAGGGTGCCTGCTGGG + Intronic
1096995039 12:55833148-55833170 TTATTGACGGGTCTCCTGCTAGG + Intergenic
1099730031 12:86489014-86489036 TTATTCAGAGAGCACCAGCTGGG - Intronic
1102682305 12:114698935-114698957 GTTTGGAGAGGGCCGCTGCTGGG - Intergenic
1105217325 13:18296450-18296472 TTATTGAAAGGGCTACTGTTTGG + Intergenic
1108602725 13:52008522-52008544 TTAATGAGAGGGCTCTTGATAGG - Intronic
1110152888 13:72276229-72276251 ATTTTGTGAGGACCCCTGCTTGG - Intergenic
1122780896 14:104142985-104143007 TCAAGGAGAGGGTCCCTGCTTGG + Intronic
1125160413 15:36636740-36636762 TTATTGAAAGGTCCCCTTCCTGG - Intronic
1125561385 15:40636148-40636170 TTATTGCAAGTGCTCCTGCTAGG + Intronic
1130228795 15:82080834-82080856 TTACTGAGAGCGTTCCTGCTGGG + Intergenic
1132763078 16:1520407-1520429 TTCTTGTGAGAGCTCCTGCTCGG - Intronic
1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG + Intergenic
1147114085 17:38285751-38285773 TTATTCAGAGGTCCCCATCTGGG - Intergenic
1148415520 17:47503439-47503461 TTATTCAGAGGTCCCCATCTGGG + Intergenic
1150940762 17:69691307-69691329 TTATTTTTAGGGCCACTGCTAGG + Intergenic
1151994535 17:77600380-77600402 TTTTTCAGAGGGCTCCTGGTGGG + Intergenic
1157770189 18:50338934-50338956 TTATTGATCCAGCCCCTGCTCGG - Intergenic
1162936920 19:13986079-13986101 TTGCTGAGAGGGCCCCTCCTGGG + Intronic
1165062440 19:33211394-33211416 GTGGTGAGTGGGCCCCTGCTCGG - Exonic
928396373 2:30945898-30945920 TTATGGAGAGGAGCCCAGCTGGG + Intronic
929295518 2:40241967-40241989 TTATTGAGTGGAACACTGCTTGG - Intronic
931176347 2:59858741-59858763 TTATTGCCAGAGTCCCTGCTTGG - Intergenic
932021710 2:68094342-68094364 TTATTAAGAGGGCCACTGACAGG - Intronic
933945089 2:87279145-87279167 TTATTTAGGTGGCACCTGCTTGG + Intergenic
934296997 2:91750232-91750254 TTATTGAAAGGGCTACTGTTTGG - Intergenic
935633394 2:105231018-105231040 TTATTGAGAGGGCAGATTCTGGG - Intergenic
936335117 2:111582445-111582467 TTATTTAGGTGGCGCCTGCTTGG - Intergenic
936613784 2:114027673-114027695 GGATTGAGAAGGCCCCTCCTAGG - Intergenic
941162194 2:162048543-162048565 TGAATGAGAGGGTCCCTGCAAGG - Intronic
948482936 2:238261823-238261845 TCATTCAAAGGGCCCCTGCGTGG + Exonic
1170059839 20:12247349-12247371 TTATAGAGACGGCTGCTGCTGGG - Intergenic
1173562324 20:44014850-44014872 ATAGTGGGAGGGCCCCAGCTGGG + Intronic
1183543204 22:38441627-38441649 TTCTTTAGGGGGCACCTGCTGGG - Intronic
953980008 3:47408879-47408901 TGATGGAGATGGCCCCTGCCTGG - Exonic
961566402 3:127766562-127766584 TTTATAAGAGTGCCCCTGCTTGG - Intronic
964883243 3:161447551-161447573 TTTTTGAGATGGCCCCTGGAGGG + Intergenic
965188404 3:165496787-165496809 TTATTGACTGGGGGCCTGCTGGG + Intergenic
969505995 4:7588118-7588140 TTATTCAGAGGGACCCAGATGGG - Intronic
974694490 4:65348071-65348093 TTATGGAGAGAGACCCTACTGGG - Exonic
976676317 4:87707715-87707737 CTGCTGAGAAGGCCCCTGCTTGG + Intergenic
979024177 4:115546668-115546690 TTATTAAGAGGTTCCCGGCTGGG - Intergenic
993699388 5:91100085-91100107 ATCTTGAAAGGGCTCCTGCTAGG + Intronic
995238537 5:109858759-109858781 TGATAGAGAGTGCCCTTGCTTGG + Intronic
997848541 5:137310237-137310259 TTATAGAGACTGCCCATGCTGGG - Intronic
999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG + Intronic
1009344644 6:62598044-62598066 TTATTTAGTTGGCCACTGCTGGG - Intergenic
1014939198 6:127418436-127418458 TTATTGAGAGAGACCTTCCTGGG - Intergenic
1016578556 6:145600819-145600841 TCATTGAGAAGCCACCTGCTTGG - Intronic
1029733047 7:102450350-102450372 CTTTTGGGAGGGGCCCTGCTGGG + Exonic
1029849306 7:103445997-103446019 TGACAGCGAGGGCCCCTGCTCGG + Intronic
1032348587 7:131139491-131139513 TCCTAGAGAGGCCCCCTGCTTGG + Intronic
1033264912 7:139876631-139876653 TTATGGAAATGGCCCCTCCTAGG + Intronic
1034342060 7:150363821-150363843 ATATTGATAGGGCCCCTGGGAGG - Intergenic
1035105405 7:156437832-156437854 ATATGGAGAAGGCCCATGCTAGG + Intergenic
1044503596 8:92991214-92991236 TTATTCAGAGGTGCCCTGCCTGG - Intronic
1044581678 8:93831935-93831957 TAATGGAGAGGGGCACTGCTTGG + Intergenic
1048453453 8:134554764-134554786 TGATTGAGAAGGCCAGTGCTGGG + Intronic
1048684372 8:136887085-136887107 TTTTTGAAAAGGCCCCTGCTAGG - Intergenic
1049128012 8:140810146-140810168 TAGTTGAGGGGCCCCCTGCTCGG - Intronic
1053471248 9:38347271-38347293 TTAACAAGAGGGCCCCTTCTGGG - Intergenic
1061763987 9:132869874-132869896 TCATGGAGAGAGCGCCTGCTTGG + Intronic
1187775940 X:22757490-22757512 TTATTGAGAGACCCTGTGCTAGG - Intergenic
1190452705 X:50596981-50597003 TAATTGAGAGAGCCCTTACTTGG - Intronic
1200962192 Y:9005926-9005948 TTTCTCAGAGAGCCCCTGCTAGG + Intergenic
1200981710 Y:9268576-9268598 TTTCTCAGAGAGCCCCTGCTAGG - Intergenic
1202128706 Y:21591148-21591170 TTTCTCAGAGAGCCCCTGCTAGG + Intergenic