ID: 999201697

View in Genome Browser
Species Human (GRCh38)
Location 5:149821222-149821244
Sequence CTTTTTCAGCTGGAGCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999201697 Original CRISPR CTTTTTCAGCTGGAGCCTAG AGG Intronic
901213669 1:7541085-7541107 CATGTACAGCTGGAGCCTCGAGG - Intronic
901952304 1:12758782-12758804 CTTGCTCAGCTGGAAACTAGGGG - Intronic
906763230 1:48399608-48399630 ATTTTTCAACTGGAGCCAAATGG + Exonic
907653862 1:56322437-56322459 GCTTTTCAGCTGGAGCCTGAAGG + Intergenic
912187446 1:107295162-107295184 CTTTTTAAAGTGGAGCCCAGTGG + Intronic
912187561 1:107297018-107297040 CTTTTTAAAGTGGAGCCCAGTGG + Intronic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
917671997 1:177281657-177281679 CTGCTTCAGCTCGAGCCTCGAGG - Exonic
918270327 1:182892132-182892154 GTTTTTCTGCTGGAGTCTTGAGG - Intergenic
920087052 1:203425099-203425121 CTAGTTCAGTTGGAGCTTAGTGG + Intergenic
921446222 1:215250090-215250112 CATGTTCAGCTGCTGCCTAGGGG + Intergenic
922023542 1:221728989-221729011 GTTACTCAGCTGGTGCCTAGTGG - Intronic
923145346 1:231193921-231193943 GTTTTGGAGGTGGAGCCTAGTGG - Intronic
923622763 1:235591510-235591532 GTTATTCAGGTGGAGCCTAAAGG - Intronic
923955418 1:239013027-239013049 CTTTTCCAGCTGGAGTACAGGGG + Intergenic
1067928890 10:50539314-50539336 CTTATTCAACTGGAGCACAGAGG - Intronic
1068338732 10:55673242-55673264 ATGTTTAAGGTGGAGCCTAGTGG - Intergenic
1069298347 10:66875285-66875307 ATTTTTCAGCTGTAGCCTTTTGG - Intronic
1071824103 10:89307394-89307416 CCCTTTCAGCAGTAGCCTAGTGG - Exonic
1071891074 10:90008130-90008152 CTTTTTCATCTGGAGAATGGGGG - Intergenic
1072451052 10:95540014-95540036 CTTTTACACAGGGAGCCTAGGGG + Intronic
1073476791 10:103759005-103759027 CTTTCTCAGCTGGTGCCTGGTGG + Intronic
1075060282 10:119252364-119252386 GGCTTTCAGCTGGATCCTAGGGG + Intronic
1075928238 10:126270859-126270881 AATTCTAAGCTGGAGCCTAGTGG - Intronic
1078370456 11:10740525-10740547 CTTTCTCAGTTGGAGGCTGGAGG + Intergenic
1078632398 11:13014972-13014994 CTTTTTCATCTTGAGTCTAGTGG + Intergenic
1081809137 11:45905556-45905578 GTTTTCCCGCTGGAGCCTTGGGG - Intronic
1082101798 11:48178988-48179010 TTTTTTAAGATGGAGGCTAGAGG + Intergenic
1082285652 11:50315406-50315428 TTTTTTCAGCTGAAGCCTTGGGG + Intergenic
1085196775 11:74677337-74677359 CTGTTTCATCTGGAGCATATGGG + Intergenic
1087205430 11:95388935-95388957 CATTTTCAACTGGTGACTAGGGG - Intergenic
1088916964 11:114234862-114234884 CTTTTTCAGCAGCAACCTGGGGG + Intronic
1089340218 11:117752275-117752297 CTTTGTCAGCCAAAGCCTAGGGG + Intronic
1089359648 11:117877253-117877275 CATTTTCAGCTAGAGCCAGGTGG + Intronic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1093017177 12:14166292-14166314 TTTTTGCAGCTTGAGCCTAAAGG - Intergenic
1094669548 12:32555888-32555910 CTGTTACAGCTGGAGCACAGTGG + Intronic
1096688751 12:53306671-53306693 CTCTTTCAGGTGGACCCAAGTGG + Exonic
1098888692 12:75985735-75985757 CAATTTCAGCTGGATTCTAGAGG - Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1102693613 12:114781010-114781032 CTTTCTCTTCTGGAGCCAAGTGG - Intergenic
1104928771 12:132327642-132327664 CTGATTCAGCTGGAGCCACGAGG - Intronic
1106262557 13:28080062-28080084 GTGTTTTAGATGGAGCCTAGTGG - Intronic
1108869019 13:54959079-54959101 CTTTTTCAGCTGGAGGGCAGTGG + Intergenic
1109260010 13:60134207-60134229 CAGTTTAATCTGGAGCCTAGTGG - Intronic
1112749849 13:102571164-102571186 CTGCTTCAGCTGGAGCACAGAGG + Intergenic
1114286946 14:21253445-21253467 TTTTTTGAGATGGAGTCTAGAGG - Intronic
1114483063 14:23047300-23047322 CTCTCTCAGCTGGAGGCCAGTGG + Exonic
1115184698 14:30672533-30672555 ATTTTTCATCTACAGCCTAGGGG - Intronic
1115938187 14:38578551-38578573 CTTTCTCAGCAGGAGGCTTGCGG - Intergenic
1116350086 14:43850238-43850260 CTTCTTCAGCTAGATCCCAGAGG - Intergenic
1116420981 14:44732068-44732090 CTCTTTCACCTCCAGCCTAGAGG + Intergenic
1117569227 14:57029782-57029804 CTTTCTCAGCTGGAGCCTTAAGG + Intergenic
1118662128 14:68026012-68026034 CTGTTTTAGCTGCATCCTAGAGG + Intronic
1119928302 14:78518550-78518572 CTGTTTCTGCTGGATCCCAGAGG - Intronic
1121201512 14:92121967-92121989 ATTTTGGAGCTGGAGACTAGCGG - Exonic
1122400834 14:101466399-101466421 AGTTTGCAGCTGGAGCCTCGGGG - Intergenic
1122518556 14:102326281-102326303 CCTGTTCATCTGGAGCCTTGGGG - Exonic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1129580844 15:76808194-76808216 CTTTTCCAGCTGCAGCCTGAGGG + Intronic
1131070915 15:89465284-89465306 CATTTTCAGCAGGGGCCTGGAGG - Intergenic
1131361081 15:91791227-91791249 CTTTCTCAGCTGGGGCTCAGGGG - Intergenic
1135028435 16:19016671-19016693 CAATTTCAGCTAGACCCTAGTGG - Intronic
1137510420 16:49094810-49094832 CTTTTTCTGCTTGAGCCAATGGG - Intergenic
1137671107 16:50279787-50279809 CATTGGCAGCTGGAGCCTTGGGG + Intronic
1138386223 16:56637502-56637524 CTATTGCAGGTGGGGCCTAGAGG + Intergenic
1140865181 16:79054376-79054398 CTTGTTCAGTTGCATCCTAGAGG + Intronic
1146988374 17:37244048-37244070 CTTTTTAAACTGGAGAATAGGGG - Intronic
1147434376 17:40398922-40398944 CTTCTTCATCTGGAACCTAAAGG + Exonic
1147441167 17:40448084-40448106 CTTCTCCAGCTAGAGTCTAGGGG + Intronic
1154434627 18:14334387-14334409 CCTTGTCAGCTGGGGCTTAGCGG + Intergenic
1155793572 18:30005266-30005288 GTTTTTCAGCTGGCCCCAAGGGG + Intergenic
1157617664 18:48996815-48996837 GCTTTTCAGGTGGAGCCTTGAGG - Intergenic
1158854841 18:61532701-61532723 GTTTTTCAGATGTAGCTTAGTGG - Intronic
1159044206 18:63353466-63353488 CTCTTGCAGCTGGAGCCTTTTGG - Intronic
1161794768 19:6380407-6380429 CTTTTTCAGCAGGTCCTTAGTGG + Exonic
1165870230 19:38966747-38966769 CCTTTTGACCTGGAGGCTAGGGG + Intronic
1167239670 19:48336069-48336091 GTTTTTCAGTGGGAGCCCAGAGG - Intronic
925002321 2:415026-415048 ATTTTTCAGCAGAAACCTAGAGG - Intergenic
925190946 2:1882962-1882984 CATTTTCAGCTTGAGCATACAGG - Intronic
925285669 2:2714180-2714202 CCTGTGCAGCTGGAGCCTTGGGG + Intergenic
926114717 2:10205151-10205173 CTAGTTCAGCTGGAGGCCAGGGG + Intronic
928124103 2:28604239-28604261 CTTTTCCACCTGGATCCTACTGG - Intronic
930499862 2:52200656-52200678 CTGTTAGAGCTGGGGCCTAGTGG - Intergenic
934079863 2:88458623-88458645 GTTAATCAGCTGGAGCCAAGGGG - Intergenic
934925750 2:98380750-98380772 CTTTTATAGCAGGAGCCTTGGGG + Intronic
938645743 2:133328282-133328304 CATTTTCAGATGGAGAATAGAGG + Intronic
939376852 2:141379899-141379921 CTTTTTCAGCTACTGCCTAAAGG + Intronic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
1169814711 20:9644444-9644466 CTTTTGCAGCTGGGATCTAGAGG - Intronic
1171474606 20:25398558-25398580 TTTTTGCAGCTGTAGCCTTGAGG + Intergenic
1173621163 20:44437047-44437069 GTTTTTCAGCTGCAGCCAGGTGG + Intergenic
1174087771 20:48021185-48021207 CTCTCTCAGCTGGAGCACAGGGG + Intergenic
1174101061 20:48126496-48126518 GTTTTAGAGCTGGAGCCTGGGGG - Intergenic
1175653847 20:60751835-60751857 CCTTTTAACCAGGAGCCTAGGGG - Intergenic
1181024210 22:20118252-20118274 CTTTTCCAGTTTGAGTCTAGTGG + Intronic
949484328 3:4523122-4523144 CTTTTGCAGCTGGGACCAAGGGG + Intronic
950981688 3:17314187-17314209 CTTCTCCAGCAGGATCCTAGGGG + Intronic
953078571 3:39594062-39594084 GTTTTGCAGGTGGAGCCTAATGG + Intergenic
953489273 3:43334607-43334629 TTTTTTGAGATGGAGTCTAGTGG + Intronic
956404086 3:68909900-68909922 CTTTCTCACCTGGAGGCTTGGGG + Intronic
957557913 3:81783811-81783833 CTTTTTCAGCTTTAGCCCATAGG + Intergenic
959681995 3:109106606-109106628 CTTGCACAGCTGAAGCCTAGGGG - Intronic
964733743 3:159894538-159894560 CTCTGTCATGTGGAGCCTAGTGG + Intronic
966354154 3:179061222-179061244 CATTTTCAGCTGGAGTCTGTTGG - Intronic
966842925 3:184104196-184104218 ATTTATCAGCTGGAACCCAGAGG + Exonic
967754145 3:193149556-193149578 GTTGTTCAGCTGGAGACCAGAGG - Intergenic
968199640 3:196740758-196740780 CTGTTTGAGCTTCAGCCTAGGGG + Intronic
968452612 4:682323-682345 CTTCTTCAGCTGCATCCTGGCGG - Exonic
971487302 4:27173276-27173298 CTTCTTCAGATGCAGCCTGGTGG + Intergenic
976527147 4:86106766-86106788 TTATTTCAGCTGTAGCCTGGTGG - Intronic
978357796 4:107895528-107895550 CTTTTTGATCTGAAGACTAGGGG + Exonic
979655571 4:123189415-123189437 CTTTTTCAGCTAGAGCCCTTTGG + Intronic
982537563 4:156625765-156625787 CCTTTTCACCTGAAGCCTTGTGG - Intergenic
984383364 4:179024378-179024400 TTTTTTAAGCTGGAGCATATAGG - Intergenic
985506240 5:282307-282329 GTCTTTCAGCTGGAGACTCGGGG + Intronic
987152435 5:15056457-15056479 CCTTTTCAGCTCAGGCCTAGGGG + Intergenic
990970203 5:61497434-61497456 CTTTGTTAGCTGGAGCATGGGGG - Intronic
996096105 5:119400772-119400794 CTGTTTTTGCTGGAGCCAAGAGG - Intergenic
999201697 5:149821222-149821244 CTTTTTCAGCTGGAGCCTAGAGG + Intronic
999730944 5:154476417-154476439 CTCTTTCAGCAGGAACCAAGCGG + Intronic
1004160086 6:13205338-13205360 CTTTAACAGGTGGGGCCTAGTGG - Intronic
1004194598 6:13491720-13491742 ATTTCTCAGCTTGAGGCTAGTGG + Intergenic
1010661601 6:78577821-78577843 ATTATTGAGCTGGAGACTAGGGG + Intergenic
1011607024 6:89116066-89116088 AGCTGTCAGCTGGAGCCTAGAGG + Intronic
1011744803 6:90399135-90399157 CTTTTCCAACTGGAGCCTAGAGG - Intergenic
1013484723 6:110585787-110585809 CTGTTGGAGGTGGAGCCTAGTGG + Intergenic
1013643638 6:112113324-112113346 CTTTTGCAGCTGGAACTTGGTGG - Intronic
1013928818 6:115504638-115504660 CTGTTGGAGATGGAGCCTAGTGG + Intergenic
1018233069 6:161694719-161694741 CTTTTTCACCTGGACCGTATGGG + Intronic
1019337273 7:491384-491406 GTTTCTGAGCTGGAGCCTGGTGG - Intergenic
1021246008 7:18261730-18261752 CTTTTTCTGCTAGAGCTTTGTGG + Intronic
1023083866 7:36550611-36550633 CTTTCTCAACTACAGCCTAGAGG - Intronic
1023261407 7:38362505-38362527 GCTTTACAGCTGGACCCTAGGGG + Intergenic
1024597114 7:50947468-50947490 CTGTTTCAGCTGAAGCCTGTGGG - Intergenic
1025819423 7:64948063-64948085 CTTTTTGAGCTGAAGCATAGGGG - Intergenic
1025906220 7:65788070-65788092 TTTGTTCAGCTGAAGCCTTGGGG + Intergenic
1027452772 7:78351674-78351696 CTAGTTCAGCTGTAGTCTAGGGG - Intronic
1027759544 7:82260648-82260670 TTTCTTCAGCTGTAGACTAGTGG - Intronic
1028236468 7:88368794-88368816 ATTTTCCAGTTGGAGACTAGAGG + Intergenic
1028334225 7:89631102-89631124 ATGTTGCAGGTGGAGCCTAGTGG + Intergenic
1028877650 7:95841777-95841799 CTTTTTCAGCTGCTGCCCAAGGG - Intronic
1029158292 7:98532827-98532849 CTTTGTCAGCTGGAGCCCCAAGG + Intergenic
1035846382 8:2869613-2869635 CAGTTTCAGCTGGACACTAGAGG - Intergenic
1036430166 8:8682314-8682336 CTTTTTCTTATGGAGCCTGGAGG + Intergenic
1036439792 8:8771822-8771844 CTTTTTTAGCTAGATCCTATGGG + Intergenic
1036829668 8:12012036-12012058 CTTTATTAGGTGGTGCCTAGAGG - Intergenic
1041542792 8:59005825-59005847 CTCTTTCAGCTTCAGCCAAGGGG - Intronic
1041803390 8:61823789-61823811 CTTTATCATCTGTAGCCCAGGGG - Intergenic
1049057821 8:140252891-140252913 CTTCTTGAGCTGGAAGCTAGAGG - Exonic
1053378285 9:37626874-37626896 CTTTTTTAGCAGGCCCCTAGGGG + Intronic
1060236706 9:121868872-121868894 CTTTTTCAGTGGGAGTCTTGTGG - Intronic
1060371559 9:123078100-123078122 CTTTTTCAGCTGCCTCCTAAAGG - Intronic
1060786353 9:126454377-126454399 TGTGTTCAGCTAGAGCCTAGTGG + Intronic
1186761618 X:12729383-12729405 TTTTACCAGCTGGAGACTAGAGG + Intergenic
1191608195 X:63083913-63083935 CCTCTTCAGCTGGAGACTAGAGG + Intergenic
1192161787 X:68793912-68793934 ATTTTTAAGCTAGAGCCTCGGGG + Intergenic
1199744690 X:150764656-150764678 CTCTGTCAGCAGGACCCTAGAGG + Exonic
1201772799 Y:17633136-17633158 CGTTTTCATCAGGAGCCTGGTGG - Intergenic
1201828756 Y:18272850-18272872 CGTTTTCATCAGGAGCCTGGTGG + Intergenic
1202061555 Y:20894581-20894603 CTTTTTCAACAGGACACTAGTGG + Intergenic