ID: 999202227

View in Genome Browser
Species Human (GRCh38)
Location 5:149824649-149824671
Sequence CAAGCTGGACAGATGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999202220_999202227 5 Left 999202220 5:149824621-149824643 CCCAAGTTCCAGGATCTTAACTC 0: 1
1: 0
2: 0
3: 17
4: 166
Right 999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG No data
999202218_999202227 24 Left 999202218 5:149824602-149824624 CCAAGAGTGGTCGCTGAGGCCCA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG No data
999202222_999202227 -3 Left 999202222 5:149824629-149824651 CCAGGATCTTAACTCTCCATCAA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG No data
999202217_999202227 25 Left 999202217 5:149824601-149824623 CCCAAGAGTGGTCGCTGAGGCCC 0: 1
1: 0
2: 0
3: 11
4: 89
Right 999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG No data
999202216_999202227 26 Left 999202216 5:149824600-149824622 CCCCAAGAGTGGTCGCTGAGGCC 0: 1
1: 0
2: 0
3: 14
4: 112
Right 999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG No data
999202221_999202227 4 Left 999202221 5:149824622-149824644 CCAAGTTCCAGGATCTTAACTCT 0: 1
1: 0
2: 1
3: 16
4: 203
Right 999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999202227 Original CRISPR CAAGCTGGACAGATGGTTCT GGG Intronic
No off target data available for this crispr