ID: 999204909

View in Genome Browser
Species Human (GRCh38)
Location 5:149840848-149840870
Sequence ATGTGGCACTTCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999204901_999204909 -1 Left 999204901 5:149840826-149840848 CCTGCTGAGTCTCTCCCATGTGA 0: 1
1: 0
2: 0
3: 22
4: 345
Right 999204909 5:149840848-149840870 ATGTGGCACTTCAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999204909 Original CRISPR ATGTGGCACTTCAGGGAGGA GGG Intronic
No off target data available for this crispr