ID: 999205949

View in Genome Browser
Species Human (GRCh38)
Location 5:149848170-149848192
Sequence AAAGCGCGGCCTGCCGTTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 26}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999205935_999205949 30 Left 999205935 5:149848117-149848139 CCCTTGCCAGATTGCCCTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 213
Right 999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 26
999205942_999205949 16 Left 999205942 5:149848131-149848153 CCCTGGAGGTGCTGGGTGGCCGC 0: 1
1: 0
2: 0
3: 31
4: 192
Right 999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 26
999205947_999205949 -3 Left 999205947 5:149848150-149848172 CCGCTAGGCTGGTCTGCAGGAAA 0: 1
1: 1
2: 1
3: 16
4: 161
Right 999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 26
999205943_999205949 15 Left 999205943 5:149848132-149848154 CCTGGAGGTGCTGGGTGGCCGCT 0: 1
1: 0
2: 4
3: 23
4: 229
Right 999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 26
999205937_999205949 29 Left 999205937 5:149848118-149848140 CCTTGCCAGATTGCCCTGGAGGT 0: 1
1: 0
2: 0
3: 8
4: 154
Right 999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 26
999205938_999205949 24 Left 999205938 5:149848123-149848145 CCAGATTGCCCTGGAGGTGCTGG 0: 1
1: 0
2: 2
3: 37
4: 196
Right 999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG 0: 1
1: 0
2: 1
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999205949 Original CRISPR AAAGCGCGGCCTGCCGTTTC CGG Exonic
1065878240 10:30016186-30016208 ACAGCCCGGCCAGCCGTTTTAGG + Exonic
1069024082 10:63521463-63521485 AGCGCGCGGCCTGCCGTTGGCGG + Exonic
1074678643 10:115881069-115881091 AATGCGTGGCCTGTCTTTTCTGG + Intronic
1095419365 12:42009202-42009224 AAAGCGCTGCCTGCCCTTTCGGG - Intergenic
1101640867 12:106584939-106584961 TCAGCGGGGCCTGCCGTGTCCGG - Intronic
1113550335 13:111188072-111188094 AAAGCAGGGCCTGCAGCTTCAGG - Intronic
1115029374 14:28775528-28775550 AAAGCGAGGACTCCAGTTTCTGG - Intronic
1115753623 14:36513884-36513906 AAAGCCCAGCCTGGGGTTTCAGG + Intergenic
1151675268 17:75594398-75594420 AAAGCCCGGCCTGCCCTGCCTGG + Intergenic
1152719865 17:81918164-81918186 TGAGCGCGGCCTGCCGTGTGAGG - Exonic
1159922333 18:74237414-74237436 AGAGCGGGGACTGCCATTTCAGG - Intergenic
1160695834 19:483867-483889 AAAGCGGGGCCTGGCTTTACAGG - Intergenic
1165633049 19:37317872-37317894 GAAGCCCGCCCTCCCGTTTCCGG + Intronic
945179559 2:207077881-207077903 AAAACCCGGCCTGGTGTTTCTGG - Exonic
1174762341 20:53218077-53218099 AAAGTGCAGCCTGCCATTTGCGG - Intronic
1175995417 20:62810086-62810108 AAAGCAGGGCATGCTGTTTCCGG - Intronic
957089353 3:75713821-75713843 AAAGCGCAGCCTGGCCTTTGGGG - Intronic
981951646 4:150416350-150416372 AAAGCCGGGCCTGCCATTGCTGG - Intronic
997432582 5:133850980-133851002 ACAGCCCGGCCTCCCGTCTCTGG - Intergenic
999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG + Exonic
1030196551 7:106858896-106858918 AAAGCTTGGCCTGCATTTTCTGG - Intergenic
1035582671 8:749768-749790 AGAGCGCGCTCTGCCGTTTCGGG - Intergenic
1037568934 8:20142115-20142137 AAAGCGCTCTCTGCTGTTTCTGG - Intergenic
1059351514 9:113668766-113668788 AAAGCCCTGCCTGCCCTTTGAGG + Intergenic
1061972708 9:134053551-134053573 AAAGCGCGACGTCCCATTTCCGG + Exonic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic