ID: 999206611

View in Genome Browser
Species Human (GRCh38)
Location 5:149852947-149852969
Sequence AAAATCCAACTGCCCAAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999206610_999206611 -9 Left 999206610 5:149852933-149852955 CCGGAAGGAGTACAAAAATCCAA 0: 1
1: 0
2: 2
3: 15
4: 184
Right 999206611 5:149852947-149852969 AAAATCCAACTGCCCAAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999206611 Original CRISPR AAAATCCAACTGCCCAAATT TGG Exonic
901366528 1:8755762-8755784 AAAATGCAAAACCCCAAATTGGG + Intronic
907662546 1:56406600-56406622 AAACCCCAACTGCCCACATCAGG - Intergenic
907968537 1:59357635-59357657 AAAATCCACCAACCCAAATGAGG - Intronic
908966402 1:69769902-69769924 AAAAACCAACTGGCCATTTTAGG + Intronic
909345699 1:74583779-74583801 AAAATACAAATGCTCTAATTTGG + Intronic
909589183 1:77326750-77326772 AAAATCCAGTTGTCCAAAGTAGG + Intronic
912432362 1:109635458-109635480 AGAGTGAAACTGCCCAAATTAGG + Intergenic
914324305 1:146596494-146596516 AAACTCCCACTGACCACATTTGG + Intergenic
915834046 1:159160197-159160219 CAAATCCCACCTCCCAAATTTGG + Intergenic
919208846 1:194453831-194453853 AATACCCAGGTGCCCAAATTGGG - Intergenic
921345947 1:214185289-214185311 AAAATCAAAATGCCTGAATTTGG - Intergenic
921413593 1:214864752-214864774 TAAATGCAACTGCCCAAAAAGGG + Intergenic
1063049702 10:2433675-2433697 AAAAAACAACTGCCTTAATTAGG + Intergenic
1063948239 10:11198321-11198343 AAAATAGAACTACCCAATTTGGG - Intronic
1064958026 10:20932984-20933006 AATATCCAATTGCATAAATTAGG + Intronic
1065858941 10:29854504-29854526 AGAATCCACCTGCCCTAACTTGG + Intergenic
1066992891 10:42533143-42533165 AAAATTAAACTCCCTAAATTTGG + Intergenic
1067950327 10:50729393-50729415 AAAAACAAACTACTCAAATTCGG - Intergenic
1069706003 10:70459362-70459384 AAAATACAAATGCAAAAATTAGG - Intergenic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1073537312 10:104289476-104289498 AGAATACAACTGTCAAAATTTGG - Intronic
1073590278 10:104750730-104750752 AAAATTAAACTGCACAAAATAGG + Intronic
1073604657 10:104881986-104882008 AAAATGCAAATCCCCAAATAGGG + Intronic
1073664597 10:105516481-105516503 AAACTCCAACTTCTTAAATTAGG + Intergenic
1074062045 10:109975452-109975474 AAAATGATACTGCCCCAATTTGG + Intergenic
1074440492 10:113473489-113473511 AAAACTCAACTGGACAAATTAGG - Intergenic
1079410949 11:20187052-20187074 AAAATCCAAATGCCTTAACTTGG + Intergenic
1082736368 11:56860274-56860296 AAAATCCAATTACCTAAACTTGG + Intergenic
1083414746 11:62518182-62518204 AAAATGAAGCTGCCCCAATTTGG - Exonic
1085446274 11:76603290-76603312 AGAATCGAACTGCCCAAAGGAGG + Intergenic
1086242580 11:84713488-84713510 AAAATCCAAGTGTTCAAAATTGG - Intronic
1086511408 11:87562114-87562136 AAAATGCTATTGCCCAAATGGGG - Intergenic
1087517530 11:99182492-99182514 AAAATACAGCTACCCAAAGTGGG + Intronic
1090455417 11:126844519-126844541 AGACTCCAACTGCCCTAAGTTGG - Intronic
1090541319 11:127709600-127709622 AAAATCCAAATACTTAAATTAGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1091992349 12:4965697-4965719 AAAAAGCAACTCCCCAAATTTGG + Intergenic
1093874754 12:24336976-24336998 AAACTTCTACTGCACAAATTTGG - Intergenic
1095230421 12:39732781-39732803 AAACTCAAAATGCCCATATTTGG + Intronic
1095804230 12:46300918-46300940 TAAATGCAACTGCAGAAATTTGG - Intergenic
1095821363 12:46482241-46482263 CAATTCCAACTGACCCAATTGGG + Intergenic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1101978236 12:109381469-109381491 AGATTCCCACTGGCCAAATTTGG + Intronic
1102460678 12:113097770-113097792 AAAATACATCGGCCCAAACTAGG - Exonic
1104773142 12:131377059-131377081 CAAATGCAGCTGCCCAAACTTGG - Intergenic
1105481371 13:20779905-20779927 AAAATTAAAATGTCCAAATTAGG - Exonic
1105887836 13:24657553-24657575 AAAATATAACTTGCCAAATTTGG + Intergenic
1110438562 13:75502622-75502644 GAAATCAAACTGCCCAAAGGTGG - Intergenic
1112790819 13:103000642-103000664 AATATCCAACTGCCTTAAGTGGG - Intergenic
1113286763 13:108858376-108858398 AAAATTCAAATACCCGAATTTGG + Intronic
1114772368 14:25442679-25442701 TACACCCAAGTGCCCAAATTTGG - Intergenic
1114990109 14:28276226-28276248 AAAATCTCACTACACAAATTTGG - Intergenic
1115050319 14:29053190-29053212 AGAATGCAAATGCACAAATTTGG + Intergenic
1118113014 14:62743782-62743804 AGAATGAAACTGCCCAGATTGGG - Intronic
1120546735 14:85820891-85820913 AAAATCCAAATGTCAAAATGTGG + Intergenic
1121003890 14:90474266-90474288 AGAATCCAATGCCCCAAATTAGG - Intergenic
1123829960 15:24125280-24125302 CAAATGCAAGTACCCAAATTAGG + Intergenic
1123844869 15:24289221-24289243 CAAATCCAAGTACCCAAATTAGG + Intergenic
1123860020 15:24455900-24455922 CAAATCCAAGTACCCAAATTAGG + Intergenic
1124637484 15:31374275-31374297 ACAATGCCACTGCCCAATTTAGG - Exonic
1126671818 15:51122596-51122618 AAACTCAAAATGCCCATATTTGG + Intergenic
1129797706 15:78390747-78390769 AAATTCCAACTGGACAACTTTGG - Intergenic
1131041400 15:89270740-89270762 AGGATCCAACTGGCTAAATTTGG - Intronic
1131468524 15:92675004-92675026 ATAATCCAACTGTCTAATTTTGG + Intronic
1134651836 16:15915529-15915551 AAAAGCCAACTGACCACACTGGG + Intergenic
1135139986 16:19912970-19912992 TAATTACAACTGCCCAAATGAGG - Intergenic
1140009256 16:71114350-71114372 AAACTCCCACTGACCACATTTGG - Intronic
1140226408 16:73080969-73080991 AAAACCCATCTGCACAAACTCGG - Intergenic
1140281789 16:73561721-73561743 AAAATCCAGCTACCTAAAATAGG + Intergenic
1142507416 17:373623-373645 GGAATCCAACTGTCCAAATGGGG + Intronic
1153883312 18:9439334-9439356 AAAACCCTACTGCTCAAAGTGGG + Intergenic
1157117985 18:44880406-44880428 AAAATGCAGCTGGCTAAATTTGG + Intronic
1157861766 18:51147707-51147729 GCACTCCAACTGCCCAAATATGG - Intergenic
1158025928 18:52897407-52897429 CAAATCCAACTTTCAAAATTTGG + Intronic
1158026343 18:52901721-52901743 CAAATCCAACTTTCAAAATTTGG + Intronic
1159076094 18:63683553-63683575 AAAGCCCATGTGCCCAAATTAGG - Intronic
1161422996 19:4185881-4185903 GAGATCTAACTCCCCAAATTGGG - Intronic
1164448430 19:28337529-28337551 AAAATCAAAGTGCCCTAATCAGG - Intergenic
927498853 2:23568626-23568648 AAAATCCCACTGGCCAAAGCAGG + Intronic
928447423 2:31345913-31345935 AAAACCCAACTACCAAAATCAGG + Intronic
929415310 2:41741269-41741291 AAAATCCATTTGCCCAAAGAAGG - Intergenic
930761716 2:55045740-55045762 AAAATCCAAATTCCTTAATTTGG + Intronic
930781888 2:55231760-55231782 AGACTCCCAATGCCCAAATTTGG + Intronic
932665638 2:73696324-73696346 AAAATCCAAGACCCCAAATATGG - Intergenic
934030458 2:88041028-88041050 TAAATCCAAATGTCCAAATAAGG - Intronic
934530263 2:95082100-95082122 AAAACTCAACTGACCACATTTGG + Intergenic
937947185 2:127351259-127351281 AGAATCCAACTGTCAAAATGAGG - Intronic
938958765 2:136322210-136322232 AAAGTGCAACTCCCTAAATTCGG + Intergenic
939647060 2:144713168-144713190 TAAAGCCAAATGCTCAAATTTGG + Intergenic
940470050 2:154085427-154085449 TACATCCAAATGCACAAATTGGG + Intronic
940876430 2:158902158-158902180 AAAGTAAATCTGCCCAAATTTGG - Intergenic
942262592 2:174184084-174184106 AAAATCCAAGTATCCAAAGTTGG + Intronic
942932974 2:181518289-181518311 CATATCCAACTGCTCAAATCAGG + Intronic
944617086 2:201471990-201472012 AAAATAAAACTGACAAAATTTGG + Intronic
945539807 2:211071271-211071293 AGAATTCAGCTGCCCAAAGTTGG - Intergenic
945835310 2:214832831-214832853 AAATGCCACCTGGCCAAATTTGG - Intergenic
946813875 2:223555563-223555585 AAACCCCAAATTCCCAAATTAGG - Intergenic
1170111437 20:12808346-12808368 AGAAGCCAACTGGCCAAAATTGG + Intergenic
1172413436 20:34743356-34743378 AAAATCTAACTTCCCTAATTTGG - Intronic
1173228432 20:41175620-41175642 ACAAACCTACTGCCCACATTTGG + Exonic
1176772192 21:13086461-13086483 ATAATCCCATTGCCCAAATAGGG + Intergenic
1177933563 21:27316013-27316035 TACATCCACTTGCCCAAATTTGG - Intergenic
1179808955 21:43858196-43858218 AAAATTCACCTGTTCAAATTTGG - Intergenic
1181138373 22:20785655-20785677 AAAAACCAAATGCCTAAAATTGG + Intronic
1182760645 22:32719951-32719973 AGACTCAAAGTGCCCAAATTGGG - Intronic
1184187300 22:42873393-42873415 AAAACCCAACTTCTCAAACTGGG + Intronic
951288899 3:20851233-20851255 AAAATGCAACTTTCCAAACTTGG + Intergenic
951691190 3:25398041-25398063 CATATCCAAATCCCCAAATTAGG - Intronic
952283278 3:31944070-31944092 AATATGCAACAGCCTAAATTGGG - Intronic
953609720 3:44437629-44437651 AAACTCCAACTCCCCTAAGTTGG + Intergenic
953739677 3:45526864-45526886 AAAAACCAAATGTCCAAAATGGG + Intronic
957671470 3:83308334-83308356 AAAATCCATCTGCCATAATAAGG - Intergenic
959153668 3:102639674-102639696 AAAATCCAAATGCCTTAATATGG - Intergenic
962657653 3:137565073-137565095 AAAAACCAAAAGCCCAAAATGGG - Intergenic
962811712 3:138964013-138964035 AGAATCTAACTACTCAAATTTGG + Intergenic
963492366 3:146017546-146017568 AGATTCCCACTGACCAAATTTGG - Intergenic
965801452 3:172498051-172498073 CACATCCAGCTGCACAAATTTGG + Intergenic
966717933 3:183032375-183032397 AAAATACAACCCCCCAAATCTGG - Intronic
967208808 3:187148608-187148630 AAAATATAACTTCCCAAAATTGG - Intronic
967376936 3:188814784-188814806 AACATCCAACTTCCCACAGTGGG - Intronic
967393978 3:188986276-188986298 TAACTCAAACTCCCCAAATTTGG - Intronic
967699086 3:192570559-192570581 TAAATCCAGCTAACCAAATTTGG - Intronic
969076100 4:4578991-4579013 AAAACCCAGTTGCCCAGATTTGG + Intergenic
969247864 4:5947280-5947302 ACTCTCCAACTGCTCAAATTGGG - Intronic
969685622 4:8672427-8672449 AAAATGCAAATTCCCAAGTTTGG + Intergenic
971439209 4:26661613-26661635 AAAACCCAAATAGCCAAATTAGG + Intronic
975601525 4:76105092-76105114 TAAATCCAACAGTGCAAATTTGG - Intronic
976785271 4:88812415-88812437 AAAATCCAAATGCCTAAATCTGG + Intronic
976961537 4:90981990-90982012 AAAATCTAACTGCCTAACTTAGG - Intronic
979478331 4:121184447-121184469 AGAATCCCACTGGCCAAACTGGG - Intronic
982137519 4:152285857-152285879 ATAATCCAACTACCCAAAGAAGG - Intergenic
982962807 4:161861583-161861605 AAAATCCAGCAGTCCAATTTTGG + Intronic
984810787 4:183795054-183795076 AAGCTCCCACTGGCCAAATTTGG + Intergenic
986445013 5:7813882-7813904 AAATTACAACTGCCCAAGTAAGG - Intronic
988092672 5:26563138-26563160 AAACTCCAACAGCCCAATCTAGG + Intergenic
991440997 5:66649224-66649246 AAAACTCAACAGCTCAAATTTGG - Intronic
991598441 5:68328253-68328275 AAAACACAACTGCCCAAGTCAGG - Intergenic
991789002 5:70220481-70220503 AACATCCAACTGCACCAATTTGG + Intergenic
993030309 5:82697977-82697999 ATAATTCAACTGCCCAGAATGGG + Intergenic
993665896 5:90695447-90695469 AATATATAACTGCCCAAATGAGG - Intronic
995226054 5:109702417-109702439 AAAATGCAACACCCCAAATAGGG + Intronic
995739857 5:115344644-115344666 CAAACCCCACTGCCAAAATTTGG - Intergenic
996152374 5:120055514-120055536 AAAATCAAACTGCCTGAAATTGG + Intergenic
999206611 5:149852947-149852969 AAAATCCAACTGCCCAAATTTGG + Exonic
1000201580 5:159015982-159016004 AAAATCCATATGCCCATATCTGG + Intronic
1000307325 5:160006869-160006891 AAAGTGCAACTGGCCCAATTTGG - Intergenic
1001417758 5:171559212-171559234 AAAATCCAACTTCACCAAATTGG - Intergenic
1003473434 6:6459307-6459329 AAAACCCAAATGCACCAATTTGG + Intergenic
1005742720 6:28807823-28807845 AAAATGCAACTGCCGAAACCCGG + Intergenic
1006203830 6:32321507-32321529 AAAATCCATATGCCCATGTTTGG - Intronic
1007068693 6:39018833-39018855 AAAATCCATCTGGCCATTTTTGG - Intronic
1007542096 6:42656393-42656415 AAACTCCCACTGACCAAAATGGG - Intronic
1007659306 6:43473279-43473301 AAAATTCAACATCCCAAGTTAGG + Intergenic
1010556395 6:77284528-77284550 AGATTCCCACTGACCAAATTTGG - Intergenic
1010567118 6:77429693-77429715 AAAATCCAAGAGCTAAAATTTGG - Intergenic
1011051463 6:83155312-83155334 AAAATTAAACTGGCCAAATGTGG + Intronic
1011057929 6:83226256-83226278 AAAATACAACTACATAAATTTGG + Intronic
1011471431 6:87711807-87711829 AAAACCCAACTGCACTGATTGGG - Intergenic
1012146289 6:95687135-95687157 ACAATGCAATTACCCAAATTGGG - Intergenic
1013659510 6:112280630-112280652 AAAATCCAAGGGCCAAAGTTGGG + Intergenic
1015345512 6:132152772-132152794 AAAATTAAACTGTCAAAATTTGG + Intergenic
1017225441 6:152015826-152015848 AAATTCCAAATGGCGAAATTTGG - Intronic
1017508935 6:155094927-155094949 AAAATTTAACTGTCCAGATTAGG - Intronic
1018620992 6:165729526-165729548 CCCATCCAAGTGCCCAAATTGGG - Intronic
1019912252 7:4107663-4107685 AAAATCCAACTGAAAAAATGTGG + Intronic
1023181583 7:37489712-37489734 AACTTCCAACTGCCACAATTAGG - Intergenic
1023613504 7:41995057-41995079 AAAATCCAGGTGGCAAAATTTGG - Intronic
1025769450 7:64490489-64490511 AAATTCCAATGGCCTAAATTGGG - Intergenic
1030660880 7:112218043-112218065 CAAATCAATCTCCCCAAATTTGG - Intronic
1031468964 7:122146650-122146672 ACAATCCAACTGGGTAAATTAGG + Intergenic
1032342245 7:131085452-131085474 AAACTCCTACTGGCCAAATCTGG + Intergenic
1032771018 7:135056315-135056337 ACAATCCAAGTGTCCACATTAGG - Intronic
1033101178 7:138473786-138473808 ACAATCAAATTGCCCAAATTTGG + Intronic
1033126996 7:138715179-138715201 AAAACCCAACAACACAAATTTGG - Intronic
1033269214 7:139915611-139915633 TAAATCCAGCTTCCCAAATCAGG - Intronic
1034587100 7:152103469-152103491 AAAATTTCACGGCCCAAATTTGG - Intronic
1034700980 7:153095633-153095655 GCACTCCAAATGCCCAAATTTGG + Intergenic
1036602998 8:10280056-10280078 AAAATATAACTTCCCAAAGTTGG - Intronic
1036978616 8:13443357-13443379 AAAAAAAAACTGCCCAAATGAGG + Intronic
1038009215 8:23460941-23460963 AAAATACAACTTCCCAAAACTGG + Intergenic
1038168575 8:25108041-25108063 AGAAAACAACTGTCCAAATTTGG - Intergenic
1040626631 8:49157292-49157314 AACATCCTTCTGCCCAAAGTAGG - Intergenic
1040746540 8:50650117-50650139 AAAATACAAATACCCATATTTGG + Intronic
1041130970 8:54699736-54699758 AAATTCCAATTGCTGAAATTTGG - Intergenic
1041415423 8:57602722-57602744 AAAATCAAACTGCACAAAATAGG + Intergenic
1041971265 8:63745975-63745997 AAAATTCAACGGCCCAGACTAGG - Intergenic
1043066704 8:75580665-75580687 AAAATACAACTTACCAAATGTGG + Intergenic
1043432082 8:80204963-80204985 AAATTCCCACTGGCCAAATCCGG + Intronic
1043458467 8:80435980-80436002 AAAGTCCAAGTGCCCTAATAAGG + Intergenic
1044777944 8:95713312-95713334 AAAATCCAAGTGGCCAAGGTAGG - Intergenic
1045694352 8:104791466-104791488 AAAATCCAACTGCTCATGTTTGG - Intronic
1046914359 8:119663919-119663941 CAAATCCAACTGCAAAACTTTGG - Intronic
1047459456 8:125048318-125048340 AAAATCAAACTTCTCAATTTTGG + Intronic
1047906704 8:129480388-129480410 CAAATTCCACTGTCCAAATTTGG + Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1050627934 9:7525829-7525851 AAGCTCCAACTGGCCAAATGTGG - Intergenic
1051036353 9:12750771-12750793 AAAAATCAATTGCCCATATTGGG + Intergenic
1051464690 9:17364616-17364638 AATATCCCACTGCCCAAAATGGG - Intronic
1051995742 9:23215234-23215256 AAATTCCCACTGACCAAAGTTGG + Intergenic
1055409150 9:76009367-76009389 AAAATCCTACTACCCACTTTGGG + Intronic
1055493688 9:76832944-76832966 AAAATTCAACTTGCCAAAATTGG + Intronic
1056258238 9:84822426-84822448 AAATTCCTATTGCCCACATTTGG - Intronic
1056351398 9:85752561-85752583 ACAATACAACTGCAAAAATTAGG - Intergenic
1057612517 9:96558345-96558367 ATACTGCAACTGCCCTAATTTGG + Intronic
1059183898 9:112247018-112247040 AAAATCCAACAGTCCAACCTGGG + Intronic
1061736038 9:132659851-132659873 AAAAGGCAACTGCCCACACTTGG + Intronic
1203417058 Un_KI270333v1:71-93 AATATCAAAGTTCCCAAATTGGG + Intergenic
1188010362 X:25048818-25048840 AAATTCTAACTACCCTAATTTGG + Intergenic
1189063864 X:37785130-37785152 TTAAACCAACTGCCAAAATTGGG + Intronic
1189344340 X:40229263-40229285 AAATTCCAAATGTCCAAATCTGG - Intergenic
1190975189 X:55392489-55392511 AAAATCCATCTACCCAAAGGAGG + Intergenic
1192208926 X:69114896-69114918 AAAGCCCAACTGCACAAATACGG + Intergenic
1200237551 X:154475583-154475605 AACAACCAACTGCACAAATAAGG + Intergenic