ID: 999212154

View in Genome Browser
Species Human (GRCh38)
Location 5:149899277-149899299
Sequence TATCACATGGGGCAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999212154 Original CRISPR TATCACATGGGGCAGCAACC TGG (reversed) Intronic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG + Intergenic
907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG + Intronic
907783710 1:57591337-57591359 TTTCACATGGGCCAGTCACCAGG - Intronic
908689076 1:66756863-66756885 TACCCCATGGGGAAGCAACATGG - Intronic
914355293 1:146879443-146879465 TATTACATGGGGCTGAAACTAGG - Intergenic
914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
916103713 1:161414808-161414830 TAGCACGTTGGGAAGCAACCTGG + Intergenic
917241258 1:172951032-172951054 TATCACATGGAGCAGAGACATGG - Intergenic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
919423883 1:197405796-197405818 TCTCAGACGGGGCAGCTACCGGG - Intronic
919905809 1:202077614-202077636 CTTCACCTGGGGCAGCACCCAGG - Intergenic
920129988 1:203724651-203724673 ATTCTCATGAGGCAGCAACCTGG + Intronic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067034162 10:42900536-42900558 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1068106793 10:52628272-52628294 TTTCACATAGATCAGCAACCTGG + Intergenic
1070379678 10:75869359-75869381 TATCACATATGGCAGCAATATGG - Intronic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG + Intergenic
1075272227 10:121062246-121062268 TATCATAAGGGGCAGCAAAGTGG + Intergenic
1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG + Intronic
1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG + Intronic
1079755545 11:24255436-24255458 TATAACATGGAGCACCAACATGG + Intergenic
1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG + Intronic
1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1085480866 11:76821569-76821591 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG + Intergenic
1087670336 11:101098973-101098995 TATCACATGGTATAGGAACCTGG + Intronic
1087714152 11:101587483-101587505 TATCACATGTAGAATCAACCGGG + Intronic
1090476606 11:127027571-127027593 TAACAGCTGGGGCTGCAACCTGG - Intergenic
1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094319853 12:29172234-29172256 TCCCAGATGGGGCAGCGACCAGG - Intronic
1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1095651924 12:44621140-44621162 TAGCACATGTGGCAGCAAGGAGG - Intronic
1097132434 12:56822475-56822497 TATCACATGGGGCAAAACCTTGG - Intergenic
1105775145 13:23653080-23653102 TAGCACAGGGGGCAGGAAGCTGG - Intronic
1106098823 13:26676208-26676230 TATTACATGGGTGAACAACCTGG - Intronic
1106794253 13:33188069-33188091 TTTCCCATGGCCCAGCAACCAGG - Intronic
1108381487 13:49859081-49859103 TCTCACAAGGGACAGAAACCAGG - Intergenic
1108784392 13:53877764-53877786 TATTCCATGCGGCACCAACCAGG + Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1111916300 13:94364338-94364360 TACCCCATGGGGCACCAACCAGG - Intronic
1114643092 14:24237703-24237725 TATCATCTGGGGCAGCCAGCAGG + Intronic
1121547924 14:94775988-94776010 TATCATATTGGTCAGCAATCTGG + Intergenic
1124267296 15:28248183-28248205 TGTCACATGGGGGAGCCAGCTGG - Intronic
1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG + Intronic
1134807471 16:17138242-17138264 TATCACATGGTGCCCAAACCTGG - Intronic
1135513902 16:23113331-23113353 TATCACATGAGACAGAACCCAGG + Intronic
1135619545 16:23943898-23943920 GATCACATGGGGAAGGCACCAGG + Intronic
1139978724 16:70836087-70836109 TATTACATGGGGCTGAAACTAGG + Intronic
1141394737 16:83694645-83694667 GGTGACATGGGCCAGCAACCAGG + Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1143369065 17:6427039-6427061 AATCACTCGGGGCATCAACCTGG + Exonic
1143734095 17:8898286-8898308 TATCAAATGGGGAACAAACCTGG - Intronic
1152139172 17:78526213-78526235 CACCACATCGGGCAGCAGCCAGG - Intronic
1153466284 18:5391269-5391291 TATTACATGAGTCAGAAACCTGG - Intergenic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1156625571 18:38903513-38903535 TATGACATGGGGCAGAAATCAGG + Intergenic
1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG + Exonic
1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG + Intergenic
1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG + Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1164126765 19:22325533-22325555 TATAACATGGCTCAGCACCCAGG + Intergenic
1164256337 19:23531530-23531552 TATCACAGGGCCCAGCATCCAGG - Intronic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1165904504 19:39185440-39185462 GATGAGATGGGGCAGCAAGCAGG + Intergenic
1168063665 19:53907853-53907875 TATCACAGAGGGCACCAACGTGG + Intergenic
927141311 2:20132812-20132834 TTTCAGATGGGGCAGAAAACAGG + Intergenic
930037906 2:47099345-47099367 TCACACCTGGGGCAGCAGCCTGG - Intronic
931179576 2:59885895-59885917 TTTCACATGCTGCAACAACCAGG + Intergenic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
933327381 2:80855370-80855392 AAGCACATGGGGCAGGATCCAGG - Intergenic
935715004 2:105931997-105932019 TATCACCTGAGGAAGTAACCAGG - Intergenic
940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG + Intronic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
943297188 2:186154207-186154229 TCTCACACGGGGCAGCTGCCAGG + Intergenic
944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG + Intergenic
1170169921 20:13399181-13399203 TATAAGTTGGGGAAGCAACCAGG - Intronic
1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1176104806 20:63380918-63380940 TGCCACAGGGGGCAGCACCCAGG - Intergenic
1178379729 21:32097728-32097750 TCTCACATGTGGGAGCAACTAGG - Intergenic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1179623201 21:42632391-42632413 TGAGACATGGGGCAGCCACCGGG - Intergenic
1179794409 21:43774540-43774562 TATCTCAGGGGGCAGCCACAGGG + Intronic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1181303779 22:21902430-21902452 TATCCCCTGGGGCACCACCCAGG + Intergenic
1181417239 22:22769388-22769410 GAACACATGTGGCAGGAACCAGG + Intronic
1182202204 22:28585374-28585396 TATCATAGGGAGCACCAACCTGG + Intronic
1182399806 22:30066778-30066800 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1184985937 22:48134133-48134155 GATAACATGTGGCAGAAACCTGG - Intergenic
958717238 3:97799925-97799947 TCTTACTTGGGACAGCAACCAGG + Intronic
960862007 3:122164491-122164513 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
962145005 3:132831694-132831716 TCTAACATGAGGCAGCAAGCAGG - Intergenic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
973785059 4:54325718-54325740 TCTCAGATGGGGCAGCTACTGGG + Intergenic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG + Intronic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG + Intergenic
988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
995870189 5:116736440-116736462 TATCACTCTGGGCAGCAGCCTGG - Intergenic
997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG + Exonic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1002377294 5:178797458-178797480 TATACCACAGGGCAGCAACCCGG + Intergenic
1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG + Intergenic
1016014903 6:139173573-139173595 TTTAACATGGGGAAGCACCCTGG + Intronic
1017405642 6:154115727-154115749 TCTGCCCTGGGGCAGCAACCTGG + Intronic
1018914271 6:168123251-168123273 TATCACAGCGGACAGCACCCCGG + Intergenic
1019446696 7:1074945-1074967 CACCACACGGGGCAGCCACCAGG - Intronic
1020797800 7:12697620-12697642 TATCACAGGGGGAAGCAAGTGGG - Intergenic
1021840995 7:24721800-24721822 GATCACATGGGGCCTCAGCCTGG - Intronic
1025781036 7:64602062-64602084 TATCGCAGGGCCCAGCAACCAGG + Intergenic
1026670346 7:72385266-72385288 TATCACATGATTCAGCAAACAGG + Intronic
1029813171 7:103069267-103069289 TTCCAGATGGGGCGGCAACCAGG - Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037539611 8:19858245-19858267 TGTCACATGGGGCAGCCATCTGG + Intergenic
1039517764 8:38147710-38147732 CATCACAGGGGACAGTAACCAGG - Intronic
1039750637 8:40475183-40475205 CTTCAGATGGGGCAGCAAACAGG - Intergenic
1040043526 8:42939759-42939781 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1044135808 8:88584437-88584459 AACCTCATGGGGCATCAACCTGG + Intergenic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG + Intronic
1050719278 9:8566901-8566923 TTTTACTTGGAGCAGCAACCAGG - Intronic
1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG + Intergenic
1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG + Intronic
1057401986 9:94731621-94731643 TATCACATAGCACAGAAACCAGG - Intronic
1058722519 9:107776155-107776177 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1060064897 9:120495543-120495565 TCTCAGATGGGGCAGCTGCCGGG - Intronic
1187147832 X:16653953-16653975 TATTACATGAGGCAGCAGGCAGG - Intronic
1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191069014 X:56380402-56380424 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1198087832 X:133297046-133297068 TATCACATGTGTCAGCCACCAGG + Intergenic
1199323328 X:146467441-146467463 TATCAAATGAGTTAGCAACCAGG + Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic
1202080331 Y:21077649-21077671 TATCACAGGATGCAGCATCCAGG + Intergenic