ID: 999212492

View in Genome Browser
Species Human (GRCh38)
Location 5:149902267-149902289
Sequence CTGTCCAAACATAAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999212483_999212492 24 Left 999212483 5:149902220-149902242 CCTTCCAATAAGCCATCTTTTTC 0: 1
1: 0
2: 1
3: 19
4: 237
Right 999212492 5:149902267-149902289 CTGTCCAAACATAAGTTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 151
999212484_999212492 20 Left 999212484 5:149902224-149902246 CCAATAAGCCATCTTTTTCCTGC 0: 1
1: 0
2: 4
3: 21
4: 256
Right 999212492 5:149902267-149902289 CTGTCCAAACATAAGTTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 151
999212486_999212492 2 Left 999212486 5:149902242-149902264 CCTGCAATCTTCTCCCCTCTCTC 0: 1
1: 1
2: 4
3: 61
4: 639
Right 999212492 5:149902267-149902289 CTGTCCAAACATAAGTTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 151
999212485_999212492 12 Left 999212485 5:149902232-149902254 CCATCTTTTTCCTGCAATCTTCT 0: 1
1: 0
2: 1
3: 85
4: 837
Right 999212492 5:149902267-149902289 CTGTCCAAACATAAGTTTTGGGG 0: 1
1: 0
2: 0
3: 29
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999212492 Original CRISPR CTGTCCAAACATAAGTTTTG GGG Intronic
900017334 1:161682-161704 CTGTACAAACATAAATTTTTAGG + Intergenic
900047593 1:520278-520300 CTGTACAAACATAAATTTTTAGG + Intergenic
900069806 1:762146-762168 CTGTACAAACATAAATTTTTAGG + Intergenic
902056408 1:13604186-13604208 CTGTGCATACATATGTCTTGGGG + Intronic
902325154 1:15695268-15695290 ATCTCCAAACTTAATTTTTGAGG + Intronic
902499683 1:16901573-16901595 CTGTCAGAACAGAAGTTTTGGGG - Intronic
904886267 1:33740943-33740965 CTTTCCAAACCTCAGTTTTCTGG + Intronic
907680983 1:56563221-56563243 CTTTCCTAAAAGAAGTTTTGTGG - Intronic
907736539 1:57118346-57118368 TTGTCCAAACATGAATTATGTGG - Intronic
908142711 1:61203780-61203802 CAGTCCAAACAAAAGTTATAGGG - Intronic
911145041 1:94543153-94543175 TTTTGCAAACATAAATTTTGTGG - Intergenic
913738831 1:121817378-121817400 TTTTCCAAACACAACTTTTGTGG + Intergenic
914665043 1:149825810-149825832 AAGCCCAAACATAAGTTTTAAGG + Intergenic
914670722 1:149868011-149868033 AAGCCCAAACATAAGTTTTAAGG - Intronic
915153400 1:153853892-153853914 GAGTCCAAACATAAATTTTCAGG + Intronic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
917128670 1:171716417-171716439 TTGTTCAAACATAAATTATGAGG - Intronic
918651716 1:186972998-186973020 CAGTCCAAGCATTAGCTTTGTGG + Intronic
918897092 1:190362049-190362071 CTGCCCACACATAGGTTATGAGG + Intronic
920986283 1:210892674-210892696 TTGTCCAAACTTTAGTTTTTTGG - Intronic
921557775 1:216619677-216619699 CTTCCCAACCATAATTTTTGAGG + Intronic
922105179 1:222507614-222507636 CTGTACAAACATAAATTTTTAGG + Intergenic
922265493 1:223980134-223980156 CTGTACAAACATAAATTTTTAGG + Intergenic
924347351 1:243085133-243085155 CTGTACAAACATAAATTTTTAGG + Intergenic
1064871070 10:19937628-19937650 TTGTCCCAACATAACTTTTCTGG + Intronic
1066729002 10:38419741-38419763 CTGTACAAACATAAATTTTTAGG - Intergenic
1071270056 10:83998729-83998751 ATGTCTGAACATAAGTCTTGAGG + Intergenic
1071923578 10:90378755-90378777 TTCTTCAAACATAACTTTTGGGG - Intergenic
1076973935 11:156910-156932 CTGTACAAACATAAATTTTTAGG + Intergenic
1078380827 11:10838828-10838850 CTGTCCAAAAATAGGATTTAGGG - Intronic
1081167502 11:39823767-39823789 CTGTCCAGACATATTTTTTAAGG - Intergenic
1086186537 11:84024045-84024067 CTGTTCATAGTTAAGTTTTGGGG + Intronic
1086342820 11:85864612-85864634 CTGCCCAAACCTAATTTTTTTGG + Intronic
1086859988 11:91914818-91914840 CTGTCAACATATAAGTTTTAGGG + Intergenic
1088502360 11:110495221-110495243 CTGGGAAAACATAAATTTTGAGG + Intergenic
1088569345 11:111206562-111206584 CTATGCAAATATAAGTTCTGAGG - Intergenic
1088611893 11:111585360-111585382 ATTTCCAAAGATAAGATTTGGGG + Intergenic
1089087967 11:115839981-115840003 GTTTCCAAAGATAAGTTCTGCGG - Intergenic
1091801211 12:3325930-3325952 CAGTCCAAACATATGTCTTTTGG - Intergenic
1093427516 12:19045098-19045120 CTTTACAAACAGAAGGTTTGTGG + Intergenic
1098835999 12:75425095-75425117 CTGTCCATACATGAGGTTTGGGG + Intronic
1099717086 12:86309634-86309656 GTGTCCAAACATGAATTTTGGGG + Intronic
1100002217 12:89850905-89850927 CTGTCCTAACTTCAGTTTTAAGG + Intergenic
1100912057 12:99375781-99375803 CTTTCCATACATAACTGTTGAGG + Intronic
1102310040 12:111837529-111837551 CTGTGCAAACATGAATTTTGGGG - Intergenic
1102921027 12:116791756-116791778 CTGTTTGAACATAATTTTTGTGG + Intronic
1104250000 12:127083761-127083783 CTCAGAAAACATAAGTTTTGTGG - Intergenic
1105328549 13:19392953-19392975 CTGTCCAGCCAAAAGTTTTAAGG - Intergenic
1105650986 13:22377827-22377849 CTGTCCCAACTTAAATTCTGAGG + Intergenic
1106374229 13:29169049-29169071 CTGTCCTATCAAAAGTTTTTGGG - Intronic
1108092312 13:46861692-46861714 CTGTCAGGACAAAAGTTTTGAGG + Intronic
1109929859 13:69201538-69201560 CTGTCAATACAGAAATTTTGGGG + Intergenic
1110943694 13:81386149-81386171 CTGTCCATCCATTACTTTTGGGG + Intergenic
1110967892 13:81724605-81724627 CTGTTAAAACATAAGATTTCTGG + Intergenic
1110983517 13:81934369-81934391 CTCTGCAGACAGAAGTTTTGTGG - Intergenic
1111195192 13:84867309-84867331 TTCTCCAAAGATAATTTTTGAGG + Intergenic
1113829019 13:113280090-113280112 ATTTCCACACACAAGTTTTGGGG - Intergenic
1114287031 14:21254451-21254473 CTATCCAAAGATAACATTTGGGG - Intronic
1116281144 14:42909503-42909525 GTGTAAAAACATAAGTTGTGAGG + Intergenic
1116689841 14:48091470-48091492 CTATTCAATCATAAGTTTAGTGG + Intergenic
1117268935 14:54121324-54121346 CACTCCAAAGATGAGTTTTGTGG + Intergenic
1117386634 14:55220751-55220773 ATCACCAAAGATAAGTTTTGAGG - Intergenic
1118656224 14:67952548-67952570 CTGTCCAAAAACATCTTTTGAGG + Intronic
1124045649 15:26147571-26147593 CTGTCCAAACCTAACATTTAGGG - Intergenic
1125168570 15:36740053-36740075 CTCTCCAAACAAAAGTTGGGGGG + Intronic
1125752663 15:42039898-42039920 ATTTCCAACCAGAAGTTTTGGGG + Intronic
1127621518 15:60739092-60739114 ATTTCAAAATATAAGTTTTGAGG + Intronic
1134185686 16:12083322-12083344 CTGTAAGAAAATAAGTTTTGAGG - Intronic
1139297050 16:65910146-65910168 CTGTCCAAGCCTAAATTGTGGGG + Intergenic
1139313948 16:66051492-66051514 CTGTCCACACATATGTTTGGGGG - Intergenic
1140471458 16:75217689-75217711 CTGTCTGAAAATAAATTTTGAGG - Intergenic
1142446328 16:90140775-90140797 CTGTACAAACATAAATTTTTAGG - Intergenic
1142461177 17:94688-94710 CTGTACAAACATAAATTTTTAGG + Intergenic
1145407436 17:22616630-22616652 ATGTCCAAATATAATTTTTAAGG + Intergenic
1145770252 17:27487644-27487666 CTGTACAAACATAAATTTTATGG + Intronic
1149004958 17:51795882-51795904 CTTTCCAAAAATAGATTTTGTGG + Intronic
1149449942 17:56742092-56742114 CTGGGTGAACATAAGTTTTGTGG - Intergenic
1151869079 17:76824352-76824374 CTGTCCAGACATCCGGTTTGTGG - Intergenic
1158691229 18:59662823-59662845 CTGTGCAAACATAAGTTTCTTGG + Intronic
1158999863 18:62963618-62963640 ATGTTCAAACATAAGTCGTGAGG - Intronic
1160492884 18:79352582-79352604 CTGTTGAAACAGAGGTTTTGAGG - Intronic
1160650878 19:227055-227077 CTGTACAAACATAAATTTTTAGG + Intergenic
925110188 2:1328456-1328478 CTCTCCAAAAAAGAGTTTTGTGG + Intronic
928223559 2:29425977-29425999 CTTTACAGACATAATTTTTGAGG - Intronic
930236576 2:48894627-48894649 AGGTCCAAACATCAGTTTTAGGG - Intergenic
936891796 2:117379200-117379222 TTGTTCAAACATAAAGTTTGAGG - Intergenic
940193933 2:151072472-151072494 CTGTCCACAAATAATTATTGAGG - Intergenic
940455255 2:153889936-153889958 CTGGCCAAAATTTAGTTTTGTGG + Intronic
940945038 2:159606625-159606647 TTGTACAAGGATAAGTTTTGAGG - Intronic
942040523 2:172057496-172057518 CTGACCAAACACACGCTTTGGGG - Intronic
942774881 2:179569617-179569639 CTGTCAAAACAAAACATTTGTGG - Intronic
943751407 2:191513558-191513580 CTTTCAAAACATAACTTTTAAGG + Intergenic
944282483 2:197913764-197913786 GTGTCCAACCATAGGTTTGGAGG - Intronic
1169619557 20:7490204-7490226 CTTTCTAAAGATAGGTTTTGGGG + Intergenic
1170885815 20:20339060-20339082 CTGTGCAAAAATGATTTTTGTGG + Intronic
1174432666 20:50481845-50481867 TTTGCCAAAAATAAGTTTTGAGG - Intergenic
1175415545 20:58798391-58798413 ATATACAAACATAAGTTTAGAGG + Intergenic
1175623951 20:60475039-60475061 CTCTCCAGAGATAAATTTTGTGG + Intergenic
1177018649 21:15824144-15824166 CTGTCCAAATATAAAACTTGGGG - Exonic
1178367553 21:31999953-31999975 CTGTGAAAACATGAGTTTGGTGG - Exonic
1183003971 22:34884748-34884770 CCGCCCAAACCTTAGTTTTGAGG + Intergenic
949664659 3:6323311-6323333 CTGTAAATACATTAGTTTTGAGG - Intergenic
951021306 3:17783415-17783437 CTGGCCAAACATCAGTTCTATGG + Intronic
951693683 3:25423802-25423824 TTGTCTCAACATTAGTTTTGGGG - Intronic
951946792 3:28146854-28146876 TTGTCCAAAAAAAATTTTTGAGG + Intergenic
953355873 3:42255758-42255780 CTATCAAAACATAAGTGTGGTGG + Intergenic
955622171 3:60876696-60876718 CTTTTCAAACTTAAGTTTAGGGG + Intronic
955924113 3:63989146-63989168 CTGTCCCAACGTGAGCTTTGTGG + Intronic
962835956 3:139188674-139188696 CAGGCCAATCATAAGATTTGGGG + Intronic
964216123 3:154285131-154285153 CTACCAAAACATAAGTTGTGAGG + Intronic
968366953 3:198192932-198192954 CTGTACAAACATAAATTTTTAGG - Intergenic
973835562 4:54806054-54806076 TTGTCCAATCGTAGGTTTTGGGG - Intergenic
974755708 4:66204228-66204250 TTTTCCAAACATAATTTATGTGG - Intergenic
977123397 4:93132480-93132502 CTGTCCACAATTAAGTTTGGGGG + Intronic
979255363 4:118602541-118602563 CTGTACAAACATAAATTTTTAGG - Intergenic
979332975 4:119437972-119437994 CTGTACAAACATAAATTTTTAGG + Intergenic
979567334 4:122169270-122169292 ATGTCCAAAGATAAGAGTTGTGG + Intronic
980488604 4:133494426-133494448 CTGAACAAACAGAAGTTATGTGG + Intergenic
985110078 4:186539467-186539489 GTGTCAACACATAAATTTTGGGG - Intronic
985179946 4:187248919-187248941 CTCTCTAAACATAAGTTTAAGGG - Intergenic
989765684 5:45080714-45080736 ATGTCCAGAAATAACTTTTGGGG - Intergenic
993360760 5:86972896-86972918 CTATCCACACATAAATTGTGTGG - Intergenic
999005130 5:147967865-147967887 GTGTTCAAACATCAGTTTTCAGG + Intergenic
999212492 5:149902267-149902289 CTGTCCAAACATAAGTTTTGGGG + Intronic
1000005793 5:157183676-157183698 GTGGCTAAATATAAGTTTTGTGG + Intronic
1000370272 5:160528424-160528446 TTGTACATACATAAGTTTTCAGG - Intergenic
1000780440 5:165473749-165473771 CATTCCAAAGATAAGTTCTGAGG - Intergenic
1002726178 5:181298130-181298152 CTGTACAAACATAAATTTTTAGG - Intergenic
1003436504 6:6093540-6093562 CTGTCTTAACAGATGTTTTGTGG + Intergenic
1008353734 6:50525961-50525983 CTCTCCAAACCTAACTATTGAGG - Intergenic
1008895173 6:56544904-56544926 CTGTCTAAACCAAATTTTTGGGG - Intronic
1012823008 6:104112264-104112286 CTGCCCAAACCAAAGTCTTGGGG - Intergenic
1013081245 6:106815301-106815323 CTGTCCATATATAATTCTTGGGG - Intergenic
1015381959 6:132579932-132579954 CTGGCCAAACATTAGGTTTCTGG + Intergenic
1015578998 6:134703014-134703036 TTGTCTAAAAATAAGTTTGGAGG + Intergenic
1015858599 6:137652278-137652300 CTCTCCAAATATAAGGTTAGAGG - Intergenic
1023397458 7:39764382-39764404 CTGTACAAACATAAATTTTTAGG - Intergenic
1024071055 7:45785653-45785675 CTGTACAAACACAAATTTTTAGG - Intergenic
1025135215 7:56406082-56406104 CTGTACAAACATAAATTTTTAGG + Intergenic
1026040842 7:66866474-66866496 CTGTACAAACATAAATGTTTAGG - Intergenic
1027993749 7:85397080-85397102 ATGTCAAAAAATATGTTTTGGGG + Intergenic
1031826220 7:126569313-126569335 CTGTGCAAACAATAGTTATGTGG - Intronic
1032433059 7:131878644-131878666 CTGTCCTCACAGAAGTTTGGGGG - Intergenic
1033598548 7:142873341-142873363 CTGTCCAAACATAAGTGGGGTGG + Intronic
1035931466 8:3784891-3784913 CTTTACAAACATCATTTTTGTGG + Intronic
1036045327 8:5133722-5133744 CTGACCATACATAGGTTATGTGG - Intergenic
1036419697 8:8584159-8584181 CTGTTCACAGTTAAGTTTTGCGG - Intergenic
1036566900 8:9945483-9945505 ATGTCAACACATATGTTTTGGGG + Intergenic
1036665851 8:10737636-10737658 CTGTGTAAATATAAGTTTTAAGG + Intronic
1041524764 8:58792834-58792856 CTGTCCCAAGAAAAGTTTTAGGG - Intergenic
1047344838 8:124017412-124017434 CAGACCCAACATTAGTTTTGGGG - Intronic
1048786685 8:138058065-138058087 TGGTCCAAACATAAGTTTTCAGG - Intergenic
1049133732 8:140873999-140874021 CTGTAAAAAAATAAGTTTAGTGG - Intronic
1050718937 9:8562731-8562753 CTGGCCAATAATATGTTTTGAGG + Intronic
1052118464 9:24678281-24678303 ATATGCAAACATAAGTTTAGGGG - Intergenic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG + Intergenic
1053878126 9:42564001-42564023 CATTCCAAACATGAATTTTGTGG + Intergenic
1053894534 9:42730365-42730387 CATTCCAAACATGAATTTTGTGG - Intergenic
1054233568 9:62537693-62537715 CATTCCAAACATGAATTTTGTGG - Intergenic
1054264209 9:62902745-62902767 CATTCCAAACATGAATTTTGTGG - Intergenic
1056481941 9:87014686-87014708 CTGTAGAAACATAAGTTTTCAGG + Intergenic
1059236761 9:112767416-112767438 CGGACAAAACATAAGTTTTTAGG + Intronic
1060122953 9:121012596-121012618 TTCTACAAACATAAATTTTGTGG + Intronic
1060942110 9:127548786-127548808 CTGTCCAACTCTAAGGTTTGGGG - Intronic
1062751309 9:138255776-138255798 CTGTACAAACATAAATTTTTAGG - Intergenic
1203650289 Un_KI270751v1:112404-112426 CTCTACAAACATAAGTATTGGGG + Intergenic
1185943391 X:4346547-4346569 CTGTCCAGAAATGAGTGTTGAGG + Intergenic
1186810987 X:13188213-13188235 CTATGCAAACATGGGTTTTGAGG - Intergenic
1187251934 X:17606472-17606494 CTCTTCAAACATAAGTTTGCAGG + Intronic
1187516382 X:19974963-19974985 CTGTAAAAACATTAGCTTTGGGG + Intergenic
1187742615 X:22372891-22372913 CTGTGCAAACAAACGGTTTGTGG + Intergenic
1191798284 X:65047177-65047199 GTTTCCAAACTGAAGTTTTGTGG - Intergenic
1194248998 X:91550076-91550098 ATGACCTAACATAAATTTTGTGG + Intergenic
1194746859 X:97637669-97637691 CTGACAAAACGTAAGTTTTTTGG + Intergenic
1195746754 X:108126344-108126366 CTGTCCAAGCAAAAGTCCTGAGG - Intronic
1196902600 X:120400651-120400673 CTGTCAAAATATCAGTTTTCTGG - Intergenic
1196974831 X:121147967-121147989 ATTTCAAAACATAAATTTTGAGG - Intergenic
1198627532 X:138594532-138594554 CTATACAAACATAAGTTCAGGGG + Intergenic
1198897278 X:141469642-141469664 CTGTACAAACATTATTTTTAAGG - Intergenic
1200567956 Y:4791304-4791326 ATGACCTAACATAAATTTTGTGG + Intergenic