ID: 999215865

View in Genome Browser
Species Human (GRCh38)
Location 5:149934594-149934616
Sequence ATGGCTGTGAATAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999215865_999215874 15 Left 999215865 5:149934594-149934616 CCATCCACTTTATTCACAGCCAT 0: 1
1: 0
2: 1
3: 34
4: 251
Right 999215874 5:149934632-149934654 ATCCTTCCCATTCATTATGGGGG 0: 1
1: 0
2: 0
3: 16
4: 161
999215865_999215873 14 Left 999215865 5:149934594-149934616 CCATCCACTTTATTCACAGCCAT 0: 1
1: 0
2: 1
3: 34
4: 251
Right 999215873 5:149934631-149934653 CATCCTTCCCATTCATTATGGGG 0: 1
1: 0
2: 3
3: 12
4: 190
999215865_999215872 13 Left 999215865 5:149934594-149934616 CCATCCACTTTATTCACAGCCAT 0: 1
1: 0
2: 1
3: 34
4: 251
Right 999215872 5:149934630-149934652 ACATCCTTCCCATTCATTATGGG 0: 1
1: 0
2: 1
3: 12
4: 133
999215865_999215871 12 Left 999215865 5:149934594-149934616 CCATCCACTTTATTCACAGCCAT 0: 1
1: 0
2: 1
3: 34
4: 251
Right 999215871 5:149934629-149934651 CACATCCTTCCCATTCATTATGG 0: 1
1: 0
2: 2
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999215865 Original CRISPR ATGGCTGTGAATAAAGTGGA TGG (reversed) Exonic
901328901 1:8389386-8389408 ATGGCCGTGAATAAAGAACAAGG - Intronic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
905491347 1:38346454-38346476 ATGGCTGGGACCAAAGTGCAGGG - Intergenic
906193224 1:43912508-43912530 AGGGATGTGAATAAACTGAAGGG + Intronic
908701950 1:66911800-66911822 ATGACTTTGAATAGAATGGAAGG - Intronic
908810320 1:67975544-67975566 AAGGCTGGTAATAAACTGGATGG - Intergenic
909981654 1:82109406-82109428 ATGGCTTTGAATAAACTAAAGGG - Intergenic
910040605 1:82847066-82847088 CTGGCTTTGAATGAAGGGGATGG + Intergenic
912125152 1:106527164-106527186 CTGGCTTTGAAGATAGTGGAAGG - Intergenic
912445165 1:109730202-109730224 ATGGCTTTGAATAGAATGGGAGG + Intronic
913206706 1:116545596-116545618 ATGGCTGGGAAGCAAGTCGAGGG + Intronic
915027715 1:152847906-152847928 ATGCATGTGAAAAAAGGGGATGG - Intergenic
915484260 1:156209319-156209341 ATGGCTGTGGAAAAAGTGGAAGG + Intronic
916208622 1:162339811-162339833 ATGGCTGTGCAGAAAGCAGATGG + Intronic
916357300 1:163926515-163926537 ATGGCTGTGAATGAACTGACGGG - Intergenic
917067541 1:171113177-171113199 ATGAATGTGAATACAGTTGAAGG - Intronic
917225771 1:172780568-172780590 ATGTCTGCAAATGAAGTGGATGG + Intergenic
917581404 1:176381867-176381889 ACTGCTGGGAATACAGTGGAAGG - Intergenic
918418088 1:184333324-184333346 TTGGCTTTGAATACAGAGGAAGG + Intergenic
919655492 1:200193246-200193268 ATGGCTGGTAACACAGTGGAGGG - Intergenic
923077037 1:230619013-230619035 AGGCCTGTGACTACAGTGGAAGG + Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1064174762 10:13064968-13064990 ATGACTTTGAATAGAGTGGGAGG + Intronic
1064291628 10:14039591-14039613 ATGACTTTGAATAGAATGGAAGG - Intronic
1064533190 10:16331235-16331257 ATGGCAGTGAACAATATGGATGG - Intergenic
1066513284 10:36126075-36126097 ATGGCTTTGAATAAAGGAAAAGG + Intergenic
1067189707 10:44059192-44059214 ATAGATGTGAAGGAAGTGGAAGG + Intergenic
1068354485 10:55894169-55894191 ATGGCAGAGTATAAAGTTGAAGG - Intergenic
1068359276 10:55954579-55954601 ATGGCTGTGATTGAAGTGTGGGG - Intergenic
1069851385 10:71407436-71407458 ATGGGAGTGAATGAGGTGGATGG + Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1073615321 10:104989437-104989459 ATGGCTGGAAATGGAGTGGAAGG + Intronic
1074669242 10:115769906-115769928 ATGCCTTTGAACAATGTGGAAGG + Intronic
1075357133 10:121789673-121789695 ATGGCTGGGACTATACTGGAAGG + Intronic
1077470287 11:2755138-2755160 ATGGCTCTGAAGATAGAGGAAGG - Intronic
1080257324 11:30305593-30305615 ATGACTGGAAATGAAGTGGAAGG + Intergenic
1080610067 11:33896257-33896279 TTGGCTGTGAATAAAGATGATGG + Intergenic
1081608216 11:44540934-44540956 ATGGCTGTGAATAAATTGATTGG - Intergenic
1083505461 11:63153017-63153039 ATTTCTGTGAAGAAAGTGAATGG + Intronic
1084219978 11:67671846-67671868 GTGGCTGTGAATAAAATGAGAGG - Intronic
1085308007 11:75499278-75499300 ATGGCTGTGGACAAAGGGGTGGG - Intronic
1085355895 11:75836600-75836622 AGGGCAGTGAATGAAGTGGGTGG - Intronic
1085397157 11:76212288-76212310 ATGGCTCTGACTGAAGTGGCCGG - Intergenic
1088289491 11:108221612-108221634 ATGGCTGTGAATACTATGGGAGG + Intronic
1089955977 11:122571604-122571626 ATAGGTGTTAATCAAGTGGAGGG - Intergenic
1092183044 12:6459035-6459057 AGGGCTGCGAACAAAGTGGATGG - Intronic
1093665286 12:21805074-21805096 AATGCTGTGAATAAAGGGAAGGG - Intronic
1097740322 12:63234088-63234110 ATGACTTTGAATAAAATGGAAGG + Intergenic
1099108321 12:78523560-78523582 AGTGCTGTGAATAAAGTCAATGG - Intergenic
1101491347 12:105212601-105212623 TTGGCAATGAATACAGTGGAAGG + Intronic
1101569499 12:105940151-105940173 AGTGCTGAGAATAGAGTGGAAGG - Intergenic
1102279351 12:111606569-111606591 ATAGCTTTGAAAAAAGTGGAGGG + Intergenic
1102289034 12:111684184-111684206 AGGGCTGGGAATACAGTGGTGGG - Intronic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1105451224 13:20502146-20502168 ATGGGTGTGAATAATGGGGTGGG - Intronic
1105630261 13:22156834-22156856 ATGTCTGGGTATAGAGTGGAAGG - Intergenic
1105929267 13:25036980-25037002 ATGGCTTTGAATAGAATGGGAGG - Intergenic
1106933845 13:34696603-34696625 AGTGCTGGGAATAGAGTGGAGGG - Intergenic
1107050138 13:36038228-36038250 ATGGGTGTGAATGAAGAGGCAGG + Intronic
1107418355 13:40222251-40222273 CTGGCTTTGAATATAGGGGAAGG - Intergenic
1108048486 13:46405981-46406003 CTGGGTGTAAATAAATTGGAGGG - Intronic
1108438308 13:50423050-50423072 ATAGTTGTTAATTAAGTGGACGG - Intronic
1108442154 13:50465873-50465895 GTGGTTGTGAATACAGTGAATGG + Intronic
1110817385 13:79876964-79876986 CTGGCTTTGAAGACAGTGGAAGG - Intergenic
1111624810 13:90771501-90771523 ATGACTTTGAATAGAGTGGGAGG + Intergenic
1111710828 13:91812065-91812087 CTGACTGTGAATAAAGTGGCAGG + Intronic
1112841081 13:103578449-103578471 ATCACAGTCAATAAAGTGGAAGG + Intergenic
1113608477 13:111626871-111626893 ATGGCTGAGAATAACGGGGAGGG - Intronic
1113626401 13:111851082-111851104 ATGACTTTGAATAGAATGGAAGG - Intergenic
1114036917 14:18637860-18637882 AATGCTGTTAATAAAGTGAATGG + Intergenic
1114121722 14:19677184-19677206 AGTGCTGTTAATAAAGTGAATGG - Intergenic
1116173140 14:41428733-41428755 ATGACTTTGAATAGAATGGAAGG - Intergenic
1116479458 14:45381432-45381454 ATGAATGAGAATAAAATGGAGGG + Intergenic
1116936477 14:50745689-50745711 AAGGCAGTGGATAAAGTAGAAGG - Intronic
1118962383 14:70546583-70546605 ATGACTTTGAATAGAATGGAAGG + Intergenic
1119154214 14:72393586-72393608 ATGGCAGGGCATATAGTGGAAGG - Intronic
1119619413 14:76120590-76120612 ATTGCTGTCCATAATGTGGATGG + Intergenic
1120146074 14:80980063-80980085 ATAGAAGTGACTAAAGTGGAGGG - Intronic
1120631914 14:86901941-86901963 ATGACTATGAATACAGTGGAAGG + Intergenic
1120754489 14:88229603-88229625 ATGGCTGTGAATATATTTAAAGG - Intronic
1120758572 14:88266391-88266413 TTGGCTGAGACTAAAGAGGATGG - Intronic
1120966072 14:90168753-90168775 ATGTCAGTGAATAAGGTAGAAGG - Intronic
1121369007 14:93339918-93339940 ATGGCTCTGACTAGAGTGAACGG + Intronic
1122166445 14:99827955-99827977 TTGCCTGTGAATGAAATGGAGGG + Intronic
1124914802 15:33959479-33959501 ATGGCTATGACTGAAGTGTAGGG - Intronic
1124986112 15:34616870-34616892 CGGACTGTGAATAAAGTGGTGGG + Intergenic
1126158355 15:45586093-45586115 TTGGCTTTGAATATAGAGGAAGG - Intergenic
1126347302 15:47709585-47709607 AAGACTGTAACTAAAGTGGAAGG - Intronic
1130353241 15:83108941-83108963 ATGCCTGTCAATATAGTGCATGG + Intronic
1134859764 16:17550769-17550791 ATGACTTTGAATAAAATGGGAGG - Intergenic
1136652446 16:31684416-31684438 ATGACTTTGAATAGAATGGAAGG + Intergenic
1138539682 16:57680375-57680397 ATGGCTGGGATCAGAGTGGAGGG - Intronic
1139423800 16:66866435-66866457 AGGGCAGTGAATAAAGTGTTGGG + Intronic
1141573612 16:84950151-84950173 ATGGCTGTGCAGAAAGCTGAAGG - Intergenic
1144121515 17:12158537-12158559 CTGGCTGTGGAGAAAGGGGAAGG - Intergenic
1146765456 17:35516658-35516680 GTGGCTCTCAATAGAGTGGAGGG - Intronic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1147783851 17:42964021-42964043 ATGGCTGAGAAAAAAGGGGCAGG + Intronic
1149173950 17:53846771-53846793 CTGGCTTTGAAGAAAGAGGAAGG - Intergenic
1150475305 17:65470539-65470561 ATGACAGTGAATACAGAGGATGG + Intergenic
1150522507 17:65883836-65883858 GTGGCAGTGAATAAAGTGAATGG + Intronic
1203175992 17_KI270729v1_random:13454-13476 ATGGAACTGAATAAACTGGAAGG - Intergenic
1153575104 18:6512143-6512165 TTTGCTGGGAGTAAAGTGGAGGG + Intronic
1153811703 18:8757822-8757844 ATTGCTGTCAATAAAATGTATGG + Intronic
1157073474 18:44437817-44437839 GTGGGAGTGAATAAAGTTGAGGG + Intergenic
1157492394 18:48133264-48133286 ATGGGTGCGGATGAAGTGGAAGG + Intronic
1157943930 18:51957843-51957865 ATAGCAGTTAATAAAGTGTATGG - Intergenic
1159112973 18:64081927-64081949 ATGGCTGTGATGAAGGTGGAGGG + Intergenic
1159435523 18:68411941-68411963 TTGGCAGGGAATAAAGTGGGAGG + Intergenic
1159474239 18:68898791-68898813 ATTGCTAAGAATAAAGTGGAAGG + Intronic
1159666625 18:71169371-71169393 ATGGCTTTGAAGACAGAGGAAGG + Intergenic
1160015997 18:75141216-75141238 ATGGCTTTGAATATGGAGGAAGG + Intergenic
1164417850 19:28061166-28061188 ATGGCTGTGAACAAATTGGCTGG - Intergenic
1164432762 19:28202159-28202181 ATGGCTGGGTATAAAATGGAAGG - Intergenic
1166448088 19:42875950-42875972 CTGGATGGGAATACAGTGGAAGG + Intronic
1166452484 19:42914166-42914188 CTGGATGGGAATACAGTGGAAGG + Intronic
1166866654 19:45842486-45842508 TTGGCTGTGAGGAAAGTGGCAGG + Exonic
925733469 2:6940664-6940686 ATGGCTGTGATTGAAAAGGAGGG + Intronic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
930489909 2:52056324-52056346 ATGATTGTGAATAAAGAGGCAGG - Intergenic
930710992 2:54551039-54551061 ATGGGTGTGAATATACTTGAGGG + Intronic
931708546 2:64968234-64968256 ATGGCTGGAACTAAGGTGGAGGG + Intergenic
933645930 2:84812724-84812746 ATGCCTGGAATTAAAGTGGAAGG - Intronic
935790168 2:106583792-106583814 ATGGCAAGGAATAGAGTGGAGGG + Intergenic
936114372 2:109690446-109690468 ATGACTTTGAATAGAATGGAAGG + Intergenic
936375227 2:111935299-111935321 ATGGTTGTGAACAGAATGGAGGG + Intronic
937301608 2:120846172-120846194 GTGGCTTTGAAGAAGGTGGAAGG - Intronic
937937537 2:127258294-127258316 AAGGCTTTGAATCAAGTGGAAGG + Intronic
938441496 2:131338701-131338723 AGTGCTGTTAATAAAGTGAATGG + Intronic
938926479 2:136047837-136047859 ATGGCAGTGACTAAAGCAGATGG + Intergenic
939531469 2:143367840-143367862 ATGGCTGTAAAGAAGGTGGCCGG - Intronic
944516801 2:200520730-200520752 ATGACTTTGAATAGAGTGGGAGG + Intronic
944747384 2:202672045-202672067 ATGGCTGTGACCTAACTGGAAGG + Intronic
946470989 2:219960881-219960903 ATGGCTTTGAATAGAATGGGAGG + Intergenic
947428653 2:230006659-230006681 ATGGCTGGGAATGAAGTGGGAGG + Intronic
948142770 2:235686033-235686055 ATGACTTTGAATAGAGTGGGAGG + Intronic
948380345 2:237546273-237546295 ATGACTGTGAATAGAATGGGAGG + Intronic
1169892338 20:10466665-10466687 ATGGGTGGGAAGAAAGAGGAGGG - Intronic
1171230988 20:23484910-23484932 CTGGCTTTGAATATAGAGGAAGG + Intergenic
1174218051 20:48932298-48932320 TTGGTTGTGAGTAAAGAGGACGG + Intronic
1175841553 20:62031109-62031131 ATGGCTGAGAATATAAGGGAAGG - Intronic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1179446232 21:41432746-41432768 ATGGCTGAGAGCAAAGTGCAGGG + Intronic
1180461041 22:15564908-15564930 AGTGCTGTTAATAAAGTGAATGG + Intergenic
1180895201 22:19326546-19326568 ATGGCTGTGGTTAAAGTGTATGG + Intergenic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183598588 22:38826900-38826922 AGGGGTGTGATTAAAGTGCAGGG + Intronic
1185064648 22:48625252-48625274 ATGGCTGTGAATAGACTGGTGGG - Intronic
949426128 3:3918191-3918213 CTAGCTGTGACTCAAGTGGAAGG + Intronic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
951086795 3:18521096-18521118 ATGCCTGTGATTAAAGTCAATGG + Intergenic
951665700 3:25121076-25121098 ATGCATGTGTATAAAGTGGTGGG + Intergenic
951772770 3:26277173-26277195 ATGGCAGTTAATAATTTGGATGG + Intergenic
951843584 3:27061492-27061514 ATGGCTGGGAATAAATTGTGGGG + Intergenic
952546277 3:34422972-34422994 ATGGCTGAGAAAAAGGTGTATGG + Intergenic
954140947 3:48605092-48605114 ATGGCTGTCAATAAGGAGGGGGG - Intronic
954350123 3:50036247-50036269 ATGCCTTTTAATAAACTGGATGG + Intronic
954463717 3:50642286-50642308 ATGGCTGTGCAGAAACTGGATGG - Exonic
954546631 3:51441728-51441750 ATGGCTGTAGATGTAGTGGATGG - Exonic
954770113 3:52959447-52959469 CTGGCTGGGGATAAAGTGGTAGG - Intronic
955193009 3:56779316-56779338 ATGACAGTGGAGAAAGTGGATGG + Intronic
955259934 3:57377951-57377973 ATTGCTGTGAATGAAGCTGAAGG + Intronic
955882307 3:63560528-63560550 ATCTTTGTGAATAAAGAGGATGG - Intronic
957273032 3:78055751-78055773 ATGGCTTTGAATAGAATGGGAGG + Intergenic
959080361 3:101794441-101794463 CTGGCTGTGAAGAAGATGGAAGG + Intronic
959690242 3:109190388-109190410 ATGACTTTGAATAAAATGGGAGG - Intergenic
961458375 3:127035362-127035384 ATGGTTGTGGAGAAAGTGGCCGG + Exonic
962411091 3:135142523-135142545 ATGGATATGAATAAAGGAGAAGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966052532 3:175638392-175638414 AAGGATGTGAATAAACTGAATGG - Intronic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
968820629 4:2847907-2847929 ATGACTTTGAATAGAGTGGGAGG + Intronic
971019822 4:22523325-22523347 ATGACTTTGAATAGACTGGAAGG + Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
973150489 4:46881457-46881479 GTGACTTTGAATAAAATGGAAGG + Intronic
973575848 4:52288594-52288616 GTGGGTTAGAATAAAGTGGAGGG + Intergenic
974408507 4:61508359-61508381 ATGGCTGTGAATAAAGCTAAAGG - Intronic
975489734 4:74975454-74975476 ATGGCTGTGAATACAAGGGAAGG + Intronic
976232778 4:82862544-82862566 TTGGCCTTGAACAAAGTGGATGG - Exonic
980177023 4:129358368-129358390 ATGTCTGTGTCTAAAGTAGAGGG - Intergenic
981107949 4:140902836-140902858 ATGGCTGAGAAGACAGTGGGTGG - Intronic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
982849869 4:160299257-160299279 ATGCCTGTTTATAGAGTGGATGG - Intergenic
983043057 4:162953625-162953647 ATGACTGTGAATAGAATGGGAGG + Intergenic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
983484782 4:168320385-168320407 ATGGCGTTGAAGACAGTGGAAGG + Intergenic
983823524 4:172227438-172227460 ATGGGTGGGAGTACAGTGGATGG + Intronic
987176287 5:15313942-15313964 ATGTCTGAGAATTAAGTGGAAGG - Intergenic
988769235 5:34414744-34414766 ATGACTTTGAATAGAATGGAAGG - Intergenic
989299763 5:39876972-39876994 ATGGCAGAGAAAAAAGAGGAAGG + Intergenic
990052697 5:51527076-51527098 ATGGCTGTGAAAAAAGAACATGG + Intergenic
993025570 5:82641797-82641819 AAGCCTGTGAAAATAGTGGAGGG + Intergenic
993721523 5:91325848-91325870 ATTGCTCTGAATAAAGTTGAAGG - Intergenic
994619918 5:102150785-102150807 ATGACTTTGAATAAAATGGGAGG - Intergenic
995190722 5:109316835-109316857 ATGGGTGTGACCAGAGTGGATGG + Intergenic
996016240 5:118537281-118537303 ATGGGGGTGAATCAAGAGGATGG - Intergenic
997294215 5:132759812-132759834 ATGGCTGTGAATGAGGTGGGTGG + Intronic
997984852 5:138493659-138493681 ATGCCTGTGAATAGGGTGCATGG + Intergenic
999215865 5:149934594-149934616 ATGGCTGTGAATAAAGTGGATGG - Exonic
1000254314 5:159523433-159523455 CAGGATGTAAATAAAGTGGAAGG - Intergenic
1002012737 5:176296870-176296892 ATGGCTATGAAAAAAGGGGAAGG + Intronic
1002063140 5:176638354-176638376 ACAGCTGTGAACAAAATGGATGG - Intronic
1002215103 5:177625864-177625886 ATGGCTATGAAAAAAGGGGAAGG - Intergenic
1004425851 6:15506565-15506587 ATCACTGAGAACAAAGTGGAAGG + Intronic
1004553445 6:16672667-16672689 ATGGCTTTGAAGATAGGGGAAGG + Intronic
1005787048 6:29254626-29254648 ATGGCGCTGAAAAAACTGGACGG + Intergenic
1007199557 6:40095202-40095224 ATGGCAGTGAGTAAGGGGGATGG - Intergenic
1007402397 6:41610843-41610865 GTGGCTGTGAACAGAGAGGAAGG + Intergenic
1009477530 6:64112288-64112310 TTGGCTGTGAAAAAAATGCATGG - Intronic
1009664850 6:66662866-66662888 ATGGCTGTGAAATAAGTGCATGG + Intergenic
1009728919 6:67573656-67573678 ATGGCTGCAGATAAAGTGTAGGG - Intergenic
1010493209 6:76499530-76499552 AGGCCTCTGAATAAAGTGGTTGG - Intergenic
1012878831 6:104761164-104761186 ATTTCTGTGAAAAAAGTGAATGG - Intronic
1014008652 6:116450945-116450967 GTGACTCTGATTAAAGTGGATGG + Intergenic
1014818505 6:125959982-125960004 ATGGCAGAAAATAAAGAGGAAGG + Intronic
1017351024 6:153442373-153442395 ATGACTTTGAATAGAGTGGGAGG + Intergenic
1018333453 6:162759074-162759096 ATTGATCTGAATAAAGTGGGTGG + Intronic
1018597921 6:165503215-165503237 GTGGCTGTGAAAAGAATGGAGGG - Intronic
1021209016 7:17821822-17821844 ATGGATGTGAATATGGAGGATGG - Intronic
1021648478 7:22809584-22809606 ATGACTTTGAATAGAATGGAAGG - Intergenic
1021853952 7:24834932-24834954 TTCCCTGTGAATAAAGTCGATGG - Intronic
1022650119 7:32266882-32266904 ATGCCTGCAAATAAAGTGGCGGG + Intronic
1022743333 7:33144210-33144232 TTGGCTGTAAATAATGTGGTGGG - Intronic
1022818055 7:33932286-33932308 ACTGCTGGGAATAAAGTGGCGGG - Intronic
1023097165 7:36673029-36673051 AAGCCTGAGAATAAAGGGGAGGG + Intronic
1023981248 7:45071731-45071753 CTGGCTGTGAAGACAGAGGAAGG - Intronic
1024441698 7:49426998-49427020 GCGACTGTGAATAAAGAGGATGG + Intergenic
1026275331 7:68871393-68871415 CTGGCTGTGAGTAATGTGGGGGG + Intergenic
1027623521 7:80521396-80521418 ATAGCTGTGAATGAATTGGCTGG - Intronic
1027680761 7:81218515-81218537 TTTGCTGTGAATATAGTGTAAGG - Intergenic
1028699661 7:93762533-93762555 ATGTCTGTGAATTAAGTAGGAGG + Intronic
1031305751 7:120124591-120124613 ATGACTTTGAATAAAATGGGAGG - Intergenic
1031926488 7:127643557-127643579 ATGTCTGGGGATAAAGGGGAAGG + Intergenic
1032720333 7:134546394-134546416 AAGGCAGAGAATAAAGGGGAAGG - Intergenic
1033562848 7:142549295-142549317 AAGGCTGTGAAGAAACTGGAAGG - Intergenic
1034143096 7:148841516-148841538 ATGTCTTTAAATTAAGTGGATGG - Intronic
1034706641 7:153151755-153151777 ATGACTTTGAATAGAGTGGGAGG + Intergenic
1035047020 7:155974331-155974353 ATCTCTGTAAATAAAGTCGATGG - Intergenic
1035687072 8:1532132-1532154 ATGACTTTGAATAGAGTGGGAGG + Intronic
1037260806 8:17005803-17005825 ATGGATATGAATGGAGTGGAAGG + Intergenic
1038105836 8:24432823-24432845 ATGACTTTGAATAGAATGGAAGG + Intergenic
1042437375 8:68783207-68783229 ATGGCTTTGAACAGAGTGGGAGG - Intronic
1042891757 8:73619721-73619743 ATGCCTGTGATCAAAGTGCAAGG + Intronic
1043461534 8:80465230-80465252 AGGGATGTGGAGAAAGTGGAAGG + Intergenic
1044128278 8:88485762-88485784 ATGGCTGTTAATAAAGGTGCTGG + Intergenic
1045314633 8:101032759-101032781 ATGGCAGTCAACAAAGTGTAAGG - Intergenic
1047044031 8:121031671-121031693 ATGGGTGTGACTAAAAGGGATGG + Intergenic
1047555594 8:125926068-125926090 ATGGCAGAGATTAAAGTTGAGGG - Intergenic
1048454631 8:134566715-134566737 CTGGCAGTGAATAGAGGGGAGGG - Intronic
1049138076 8:140923917-140923939 AGGGTTGTGAATAGAGTGTAGGG - Intronic
1049448372 8:142642368-142642390 ATGACTTTGAATAAAATGGGAGG + Intergenic
1050244406 9:3672867-3672889 TTGGCTGTGATTAAAATGGAGGG + Intergenic
1050545603 9:6706289-6706311 ATGACTTTGAATACAGTGGGAGG + Intergenic
1052402001 9:28012184-28012206 GTGGCTGGGAAAAGAGTGGAGGG + Intronic
1052488059 9:29128016-29128038 ATGGCTGTCACTCTAGTGGAAGG + Intergenic
1056509717 9:87292191-87292213 TTGCCTGAGAATAAGGTGGAAGG - Intergenic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059603721 9:115810255-115810277 ATGGCTGTTAGGAAAGTGGGTGG + Intergenic
1061627515 9:131849767-131849789 ATGAGTGTGTATAAAGTGCATGG + Intergenic
1186938441 X:14476896-14476918 TTGGCTGTGAAGAAAGAGGAAGG + Intergenic
1186962749 X:14754576-14754598 ATTGCTGTGAATAGGGTTGATGG + Intergenic
1187161494 X:16769293-16769315 ATGGCTTTGAATAGAATGGGAGG + Intergenic
1188751350 X:33909157-33909179 ATGACTTTGAATAGAATGGAAGG + Intergenic
1188795708 X:34462043-34462065 GAGGCTGTGAAAAAATTGGAAGG - Intergenic
1188868133 X:35340060-35340082 ATGGCCATAAATAAACTGGAAGG - Intergenic
1188946569 X:36312244-36312266 ATGGGTGTCAATAAATTGGTAGG + Intronic
1189243810 X:39547034-39547056 AATGCTGTGAAGAAAGTGAATGG - Intergenic
1190056017 X:47181458-47181480 ATGCCTGTGAATAATGGGGCCGG - Intronic
1190516998 X:51234167-51234189 TTGGCTTTGAATATAGAGGAAGG + Intergenic
1190777236 X:53562674-53562696 CTGGCTGAGGATAAAGTGGATGG + Intronic
1190956626 X:55201383-55201405 ATGACTTTGAATAGAGTGGGAGG + Intronic
1193713245 X:84903827-84903849 ATAGCTTTAAATAAAGGGGATGG - Intergenic
1194247203 X:91530095-91530117 ATGACTTTGAATAGAATGGAAGG + Intergenic
1194359317 X:92929340-92929362 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1196656587 X:118224708-118224730 ATGGCTGTGATTAGAATAGAAGG + Intergenic
1197970776 X:132112723-132112745 ATGGCTGTGGATATAGGGGGTGG - Intronic
1197986464 X:132270959-132270981 ATGACTATGAATACAGAGGAAGG + Intergenic
1199228927 X:145412055-145412077 TTGGCTTTGAATACAGAGGAAGG - Intergenic
1199385233 X:147215819-147215841 ATGACTCTGAATAAAATGGGAGG + Intergenic
1199717875 X:150519190-150519212 AAAGATGTGAATAAAGTGGAAGG + Intergenic
1200566223 Y:4771633-4771655 ATGACTTTGAATAGAATGGAAGG + Intergenic
1200667512 Y:6045175-6045197 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1201098479 Y:10653342-10653364 ATGGATTGGAATGAAGTGGAAGG - Intergenic
1201850703 Y:18476806-18476828 ATGGCTTTGAAAACAGAGGATGG - Intergenic
1201882615 Y:18843571-18843593 ATGGCTTTGAAAACAGAGGATGG + Intergenic
1202332459 Y:23769220-23769242 ATGGCTTTGAAAACAGAGGAAGG + Intergenic
1202538310 Y:25900843-25900865 ATGGCTTTGAAAACAGAGGAAGG - Intergenic